-
No products found
because this supplier's products are not listed.
Haley N. Bridge, Clara L. Frazier, Amy M. Weeks,
bioRxiv - Biochemistry 2023
Quote:
... 5-Ethynylpicolinaldehyde (“alkyne-2PCA”) (4) was purchased from Ambeed. NHS-biotin ...
-
No products found
because this supplier's products are not listed.
John R. Cumbers, Lynn J. Rothschild,
bioRxiv - Microbiology 2022
Quote:
... The unwashed membrane was incubated in mouse anti-thymine dimer primary antibody (#MC-062, Kamiya Biomedical, Seattle, WA, USA) at a 1:3000 dilution in PBS-T buffer for two hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Naemi Luithle, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-lamin A/C (mouse, ImmuQuest (IQ332 RRID 10660272)) ...
-
No products found
because this supplier's products are not listed.
Huaqi Su, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The pooled HD samples were made up to 8 mL with PBS and equally divided into 16 aliquots of 500 µL (4 aliquots for each of the 4 SEC column types) and loaded onto IZON qEVoriginal™ 35nm or 70nm (IZON Science), or home-made Sepharose™ CL-4B or CL-6B (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Tim Vangansewinkel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A mouse intrathecal catheter (Alzet®, DURECT Corp.) was carefully inserted via this opening into the intrathecal space at the midline ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A549 EVs (100 μg; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were lysed and processed according to the manufacturer’s guidelines and the developed dot blot array was imaged using a ChemiDoc imaging system (Bio-Rad Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... in which a 5 mL glass serum vial (DWK Life Sciences, New Jersey ...
-
No products found
because this supplier's products are not listed.
Chen Jiang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Primary mouse keratinocytes were kept in culture medium (CnT-07; Cellntec) at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...
-
No products found
because this supplier's products are not listed.
Nicole Stantial, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... or anti-Top2 (TopoGen, #TG2014) antibody ...
-
No products found
because this supplier's products are not listed.
William A. Comrie, et al.,
bioRxiv - Immunology 2019
Quote:
µm in depth with 5.0 µm pores at a density of 4×105 pores/cm2 (Neuro Probe, Inc., Gaithersburg, MD). The filter frame was replaced on the 96-well plate and 25 ul (75,000 cells ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Albéric A. de Lajarte, et al.,
bioRxiv - Biochemistry 2024
Quote:
... adding a T7 promoter sequence at the forward primer (5′ TAATACGACTCACTATAG 3′) using a 2X PCR PreMix (Syd Labs, Cat. MB067-EQ2N), human cDNA (ZYAGEN ...
-
No products found
because this supplier's products are not listed.
Marije Risselada, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... Canine Ultrafiltration Probes (BASi Instruments, West-Lafayette, IN) were assembled as per manufacturer instructions [23].
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and immunostained with the following antibodies: mouse anti-HCV NS4A (Genotype 1B, 1:100, Virogen), rabbit anti-HA (1:100 ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Meropi Aravantinou, et al.,
bioRxiv - Immunology 2020
Quote:
... Virus titer was determined in CEMx174 cells (ATCC, Manassass, VA) by p27 ELISA quantification (ZeptoMetrix, Buffalo, NY) and syncytia scoring after 14 days with the calculation method of Reed and Meunch ...
-
No products found
because this supplier's products are not listed.
Evelína Šťastná, et al.,
bioRxiv - Immunology 2023
Quote:
... A biotinylated rabbit anti-pig antibody (clone KPB0499S-050, Kingfisher Biotech) at 100 ng/mL was used for detection ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Yanhua Du, et al.,
bioRxiv - Epidemiology 2019
Quote:
The genomes of SFTS virus isolates were compiled using the SeqMan program in the LaserGene software package (DNAStar). The percentage similarities of nucleotide identity or amino acid identity were calculated using the ClustalX software[16] ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Guiping Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... we observed better signals for higher probe concentration but the final concentration is limited by the throughput and cost for constructing these probes and solubility of probes in the hybridization buffer) and 3 µM of poly(dT) LNA anchor (IDT) was added to the surface of Parafilm (Bemis) and was covered with a cell-containing 18-mm coverslip ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
... the secondary antibody Histofine Simple Stain MAX PO® anti-goat or anti-rabbit (Nacalai USA, Inc., San Diego, CA) was administered for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Thomas Germe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for 10 min before incubating at 4°C overnight with monoclonal antibody (either anti-GyrA-CTD – 4D3 or anti-GyrB-CTD – 9G8; a gift from Alison Howells, Inspiralis) diluted 1/1000 in TBS-T 5% milk ...
-
No products found
because this supplier's products are not listed.
Michihito Sasaki, et al.,
bioRxiv - Microbiology 2020
Quote:
... the original stock of this virus (wild type, WT) was prepared by inoculation of Vero-TMPRSS2 cells with Mynox mycoplasma elimination reagent (Minerva Biolabs) [11] ...
-
No products found
because this supplier's products are not listed.
Daiana Martire-Greco, et al.,
bioRxiv - Immunology 2021
Quote:
... conditioned media (CM) were collected and incubated for 2 h with an anti-Stx antibody (anti-Stx2 variant from Toxin Technology, USA) to block the direct effect of Stx ...
-
No products found
because this supplier's products are not listed.
Kelsey Cremin, et al.,
bioRxiv - Microbiology 2020
Quote:
... or < 0.5 mm agarose gels were deposited on the glass surface of a 50 mm glass bottomed dish (WillCo Wells, USA, HBST-5040). A 100 μL aliquot of an overnight culture (optical density at 600 nm ~ 0.45 ...
-
No products found
because this supplier's products are not listed.
Greg. A. Timblin, et al.,
bioRxiv - Immunology 2022
Quote:
... 4-phosphopantetheine (CX11340) was from Chiralix. MPLA (tlrl-mpls) ...
-
No products found
because this supplier's products are not listed.
Assunta Senatore, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The following antigens were coated on separate 384-well ELISA plates: anti-Fd antibody (The Binding Site GmbH) 1:1000 in PBS ...
-
No products found
because this supplier's products are not listed.
Clémence Bernard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and (4) literature on interneuron connectivity (MEDLINE search for “gene name” and “synapse” and “interneuron”) ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Jacqueline M. Tokarew, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 0.4 % horseradish peroxidase solution was prepared using HRP-linked anti-rabbit secondary antibody diluted in Stabilizyme solution (SurModics SZ02). Each read was set up in triplicate on a white polystyrene 96-well plate (ThermoFisher 236105 ...
-
No products found
because this supplier's products are not listed.
A. Florentin, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads using 5 mM BS3 crosslinker (CovaChem) and then incubated with the supernatant at 4°C ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
KJ Suchacki, et al.,
bioRxiv - Physiology 2020
Quote:
... 4 μm Diamond Hydride silica column (Microsolv Technologies, NJ, USA) and a linear gradient from 65% buffer B (0.1% formic acid in Acetronitrile ...
-
No products found
because this supplier's products are not listed.
Sabrina Haas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All antibodies were diluted in antibody diluent (IW-1000, IHC World, LLC, Woodstock, MD, USA) and incubated for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Malachy Guzman, et al.,
bioRxiv - Genetics 2023
Quote:
... Each mouse was weighed with a analytical laboratory scale (Ohaus) immediately prior to recording ...
-
No products found
because this supplier's products are not listed.
Honglin Jiang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A final concentration of 5 uM of SiRhoNox (FerroFarRed, GORYO Chemical) in a serum-free culture medium was added to the dish and incubate for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Sophie Girardin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... it was first immersed in a solution of 4 % Tergazyme (Alconox, 1304-1) for 24 h to remove cell culture and proteins ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Hanna G. Budayeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... peptides were cleaned up using a 5 µl C18 Phytip (Biotage, Inc) and injected for LC-MS/MS acquisition.
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... Proteins were separated by SDS-PAGE on 4-20 % gradient precast gel (EZBiolab Precast Gel, WSHT, Shanghai) at 100 V for 75 min ...
-
No products found
because this supplier's products are not listed.
Yu-Ling Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mice were deeply anesthetized with isoflurane (4% induction, 1.5%–2% maintenance in O2; Halocarbon Laboratories, North Augusta, SC, USA) and placed in a stereotaxic injection frame (IVM-3000 ...