Labshake search
Citations for BestGene :
1 - 4 of 4 citations for Mouse Anti Canine Distemper Virus Surface Envelope Antibody 5 4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 transgenic lines were identified through the loss of y and were PCR-tested for orientation of insertion by Bestgene. We then tested these lines for expression of TdTomato and gene disruption after conditional expression of FLP Recombinase (Figure S3A-D) ...
-
bioRxiv - Cell Biology 2019Quote: ... P[acman]M-6-attB-UAS-1-3-4 constructs were integrated into PBac{yellow[+]-attP-3B}VK00031 (Bloomington line #9748) via PhiC31 mediated recombination (outsourced to Bestgene Inc.).
-
bioRxiv - Developmental Biology 2022Quote: ... The donor vector and gRNA plasmid (pCFD5-4) were co-injected into vas-Cas9 embryos (BL-55821; BestGene Inc, Chino Hills, CA) and the single RFP+ line obtained was balanced ...