-
No products found
because this supplier's products are not listed.
Ryan Murray, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were washed and cryopreserved in a 1:1 mixture of CS10 (BioLife Solutions) and Plasma-Lyte A (Hanna Pharmaceutical) supplemented with 2% HSA (Access Biologicals). Cryopreserved cells were thawed and activated with anti-CD3/anti-CD28 TransAct (Miltenyi ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Célina Reverdy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... containing either Carba-NAD,100 µM (Dalton pharma, Toronto) or OAADPr 100 µM (Santa-Cruz biotechnology) ...
-
No products found
because this supplier's products are not listed.
Laura Ohl, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Tissue was mixed with 1 mL 40:40:20 methanol:acetonitrile:water (extraction solvent) and homogenized with a benchtop lyser (SciLogex OS20-S) at 1600 mhZ for approximately 15 sec ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Robin S. Lindsay, et al.,
bioRxiv - Immunology 2021
Quote:
... 1µg/ml of 8.3 peptide (KYNKANVEL) (Chi Scientific), or 100ng/ml of OT-I peptide (SIINFEKL ...
-
No products found
because this supplier's products are not listed.
AL Seufert, et al.,
bioRxiv - Immunology 2022
Quote:
... 2% endotoxin- and fatty acid-free bovine serum albumin (BSA; Proliant Biologicals) and 10% M-CSF ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Aditya R. Yelamali, et al.,
bioRxiv - Immunology 2024
Quote:
... streptavidin-azide (SAv-azide; 2-4 azide groups per tetramer, Protein Mods) at 2-5 mg/mL stock concentration in PBS was prepared for payload conjugation by first adding DMSO to 20% final concentration as cosolvent.
-
No products found
because this supplier's products are not listed.
Christina Antoniou, et al.,
bioRxiv - Neuroscience 2024
Quote:
Nicotinamide riboside (NR) was prepared as a 100 mM stock from Tru Niagen capsules (Chromadex) and stored at 4 °C ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Jinchang Zhu, Yi He, Yong Wang, Li-Heng Cai,
bioRxiv - Bioengineering 2023
Quote:
... 4.3 mmol), and hydrazine (13.8 mL, 430.0 mmol) are added to a 60 mL high pressure tube (ACE GLASS, Sigma-Aldrich, Cat. No. Z568872). The tube is sealed ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Angelo D’Alessandro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Lysed RBCs were then mixed 1:1 with Hemoglobind (Biotech Support Group), followed by end over end rotation for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Steven C. Perry, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Oxylipin-treated platelets were stimulated with 0.25 µg/mL of collagen (Chrono-log), under stirring conditions (1100 rpm ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
... SCGB1A1 (5 μg/ml, catalog number RD181022220-01, BioVendor LLC, Asheville, NC, USA), KRT5 (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Anuj kumar Murmu, et al.,
bioRxiv - Genomics 2022
Quote:
The predicted peptide sequence of Mucin 2 of indigenous duck was derived by Edit sequence (Lasergene Software, DNASTAR) and then aligned with the peptide of other chicken breed and avian species using Megalign sequence Programme of Lasergene Software ...
-
No products found
because this supplier's products are not listed.
Y Kharel, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
Experimental autoimmune encephalomyelitis (EAE) was induced in female mice (10 weeks old) as described.44 The MOG35-55 peptide (100 µg, CSBio CS0681) was emulsified in complete Freund’s adjuvant containing Mycobacterium tuberculosis (1 mg/mL ...
-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... recombinant human epidermal growth factor (hEGF, 20 ng/ml, Chimerigen Laboratories, CHI-HF-210EGF), recombinant human platelet derived growth factor (hPDGF-AB ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
... Standards using mouse genomic DNA of known percentage methylation (0, 5, 25, 50, 75, and 100% 5mC) were obtained from EpigenDx (Hopkinton, MA) and included on each assay plate ...
-
No products found
because this supplier's products are not listed.
Eduardo Seclen, et al.,
bioRxiv - Bioengineering 2024
Quote:
CD34+ HSPCs were transfected 48 hours after thawing and expansion by combining 5 μg of each AAVS1 TALEN mRNA or 10 μg of each CD11b TALEN mRNA with 1e6 HSPC in 100 μL BTXpress Solution (BTX Technologies, Hawthorne, NY, USA) and electroporating using the PulseAgile (Cellectis, Paris, France). One μg of Via-Enh01 mRNA and 4 μg of HDR-Enh01 mRNA were also included in the electroporation mix because Via-Enh0139 protein inhibits cell apoptosis and because HDR-Enh0140 increases homologous recombination by inhibiting the non-homologous-end-joining pathway ...
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
Franz Meitinger, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... AZD1390 (ATMi; 1 μM; Chemgood LLC); Palbociclib (CDK4/6i ...
-
No products found
because this supplier's products are not listed.
Jieye Lin, Guanhong Bu, Johan Unge, Tamir Gonen,
bioRxiv - Biochemistry 2024
Quote:
... 1 was purchased from Advanced ChemBlocks Inc.
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... -C (1:500, AffinityImmuno, clone W6/32) were incubated in 250ul blocking buffer with neurons overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Jonathan Hus, et al.,
bioRxiv - Microbiology 2023
Quote:
... KS 66215 USA) were independently inoculated into a 10 ml Luria Broth (LB) medium (Aldon Corporation Rochester, NY). These were grown overnight to saturation in a 37°C incubator and shaken vigorously at 250 cycles per minute on a rotary shaker ...
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 μl of Taq-plus polymerase (NanoHelix, Korea), and 2.5 μl of 10 μM forward/reverse primer ...
-
No products found
because this supplier's products are not listed.
Chuan Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... diluted 1:60 or porcine kidney ECM (Xylyx Bio ...
-
No products found
because this supplier's products are not listed.
A. Rahman, et al.,
bioRxiv - Immunology 2019
Quote:
... Lysates (containing protein at 6mg/mL) from four donors were pooled prior to Kinex antibody microarray analysis (Kinexus Bioinformatics) (H ...
-
No products found
because this supplier's products are not listed.
Taylor Russo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and rabbit polyclonal anti-glycosyslceramide (Glycobiotech #RAS_0010, 1:3,000). Primary antibody was detected with HRP-linked donkey anti–rabbit IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Fatina Siwczak, et al.,
bioRxiv - Microbiology 2021
Quote:
... extracellular bacteria were killed and removed by treatment with 20 μg/ml lysostaphin (WAK-Chemie Medical GmbH, Steinbach/Ts., Germany) for 30 min at the vascular and hepatic side of the model ...
-
No products found
because this supplier's products are not listed.
Max Z. Levine, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... the remaining pellet was transferred to a cold 50 mL Falcon tube using a sterile spatula (SmartSpatula□, LevGo, Inc., Berkeley, CA) while kept on ice ...
-
No products found
because this supplier's products are not listed.
Hasna Maachi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 1 % (vol./vol.) human serum albumin (Celprogen, Torrance, CA) for 3 days in the presence of EdU (10 μM ...
-
No products found
because this supplier's products are not listed.
Sung Hee Ko, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analyzed by electrophoresis with precast 1% agarose gel (Embi Tec) or the Agilent High Sensitivity DNA kit (5067-4626 ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...