-
No products found
because this supplier's products are not listed.
Joseph Chapman, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and stained with 100 μg/mL EM 2-3 monoclonal antibody (Squarix, SQM003.1) (1:300 in 5% BSA ...
-
No products found
because this supplier's products are not listed.
Jessica B. Blackburn, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 25 μg of SIgA was incubated with 10 μg sputum-derived human neutrophil elastase (1 ug/uL in 0.05 M NaOAc pH 5 containing 0.1 M NaCl, Elastin Products Company, SE563GI) with or without a protease inhibitor (Sigma ...
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Elodie Darbo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 100µL of medium were added with 2X of final concentration (100 to 1.5 µg/mL) of either CCG-1423 (10010350, CAS:285986-88-1, Bertin Bioreagent, Montigny le Bretonneux, France) or CCG-100602 (10787 ...
-
No products found
because this supplier's products are not listed.
Maria O. Levitin, et al.,
bioRxiv - Genetics 2022
Quote:
... and RPS6 (NSJ Bioreagents; 1:100, mouse anti-rabbit monoclonal). After incubation with primary antibodies ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and then incubated with 150 μl of FLAG elution buffer (FLAG wash buffer 2 with 1 mg/ml 3×FLAG peptide [Protein Ark, GEN-3XFLAG-25]) overnight ...
-
No products found
because this supplier's products are not listed.
Lucie Peskova, et al.,
bioRxiv - Molecular Biology 2020
Quote:
At least 12 pooled retinal organoids per sample were homogenised using a 1 ml insulin syringe in 1 ml RNA Blue Reagent (an analogue of Trizol) (Top-Bio), followed by chloroform RNA extraction ...
-
No products found
because this supplier's products are not listed.
Stephanie H Chen, et al.,
bioRxiv - Genomics 2021
Quote:
... A pilot run on an Illumina iSeq 100 with 2 x 150 bp paired end sequencing run was performed for QC using hic_qc v1.0 (Phase Genomics, 2019) with i1 300 cycle chemistry ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Ying Li, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Samples (1 mL) collected after each 1-hr stimulation were analyzed for insulin content via ELISA (Mercodia) and normalized by the islet number (50 ...
-
No products found
because this supplier's products are not listed.
Brian Krug, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Membranes were incubated overnight with primary antibody in 1% skimmed milk in TBST: GAPDH (Advanced ImmunoChemical Inc 2-RGM2 1:1000 dilution), SOX10 (ab212843 1:1000 dilution) ...
-
No products found
because this supplier's products are not listed.
Carole J Kuehl, et al.,
bioRxiv - Microbiology 2019
Quote:
... diluted in PBS with 0.5% BSA and 0.5% Triton X-100: anti-Shigella-FITC (1/1000; #0903, Virostat); anti-E-cadherin 1:100 (610181 ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Ingrid Jin Schanke, et al.,
bioRxiv - Biophysics 2021
Quote:
... Thin films were deposited onto glass cover slips (Menzel Gläss #1, 100-150 μm thickness; WillCo Wells B.V., Amsterdam, NL). SiO2 films were deposited by E-beam physical vapor deposition using an EvoVac instrument (Ångstrom Engineering ...
-
No products found
because this supplier's products are not listed.
Wioleta Dudka, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... dNTP mix 100 mM each (BLIRT #RP65) and oligo (dT)18 primers (Bioline #BIO-38029) ...
-
No products found
because this supplier's products are not listed.
Scott P. Davies, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Viral RNA was reverse transcribed and quantified in culture supernatant using the 1-step SARS-CoV-2 Viasure Real Time PCR Detection Kit (Prolab Diagnostics/CerTest Biotec) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Bader Al Alwan, et al.,
bioRxiv - Biophysics 2020
Quote:
... the cells were incubated with Fc blocker (0.15 – 0.3 ml for each 1 x 106 cells, Innovex biosciences) on ice for 45 minutes ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Naomi Nihonmatsu-Kikuchi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes were connected to a differential headstage and amplified using a differential Extracellular Amplifier (gain of 100, ER-1) (Cygnus Technology, Delaware, PA). The high cut filter was set at 300 Hz ...
-
No products found
because this supplier's products are not listed.
Jutamas Uttagomol, et al.,
bioRxiv - Cell Biology 2019
Quote:
... cells were plated and grown for 1∼2 days on collagen-coated BioFlex 6-well culture plates with flexible silicone elastomer bottoms (BF-3001C, Flexcell® International Corporation). Each plate was placed over the loading station containing 6 planar faced posts ...
-
No products found
because this supplier's products are not listed.
Abdallah W. Abdelhady, et al.,
bioRxiv - Biophysics 2023
Quote:
... oocytes were placed with as little surrounding vitrification solution as possible onto one of three polymer sample supports (Figure S2): a 10 μm thick cryocrystallography sample support with a 100 μm aperture (MicroLoop LD 100, MiTeGen, Ithaca, NY), a flat ...
-
No products found
because this supplier's products are not listed.
Irene Pereira de Sousa, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 50 mg of dried MSPs were degassed for 1 h at 100 °C with nitrogen and then analyzed by nitrogen sorption at −196 °C (TriStar 3000, Micromeritics, Norcross, GA, USA). The morphology of MSPs was assessed by SEM (Quanta 200F ...
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Elisa Tonoli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 30 μg/ml TG2 (Zedira) in ACSF was perfused until plateau of the response was reached ...
-
No products found
because this supplier's products are not listed.
Mohammed N.A. Siddiquey, et al.,
bioRxiv - Microbiology 2020
Quote:
... 10 μg/mL ciprofloxacin (Genhunter), and either 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Hironobu Endo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... desmethyl precursor of 11C-PBB3 (Nard Institute, NP076-2), desmethyl precursor of 11C-PE2I (Nard Institute ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
Also acts on 4-nitrophenyl esters, with optimum chain-length C6 to C8.
Cat# EXWM-3489,
100 ug, contact supplier for pricing
Ask
Junfei Ma, Shuying Wang, Qianyu Ji, Qing Liu,
bioRxiv - Immunology 2021
Quote:
... pylori urease (2 μg in 50 μL, Creative Enzymes, USA) was incubated with purified IgG antibodies (64 μg/well ...
-
No products found
because this supplier's products are not listed.
Aurelie Velay, et al.,
bioRxiv - Microbiology 2020
Quote:
... ELISA anti-SARS-CoV-2 IgA and IgG (Euroimmun, Lübeck, Germany) and (2) ELISA-2: EDI™ novel coronavirus COVID-19 IgM and IgG (Epitope Diagnostics, San Diego, CA, USA). Technical characteristics of the assays are summarized in the Supplementary data (Table S1) ...
-
No products found
because this supplier's products are not listed.
Albert S. W. Kang, et al.,
bioRxiv - Biophysics 2020
Quote:
... Purification from excess OsBp was done with spin columns (TC-100 FC from TrimGen Corporation) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oscar R. Benavides, et al.,
bioRxiv - Biophysics 2023
Quote:
... in a 10 mL rotating wall vessel (RWV) bioreactor (Synthecon) and fixed with neutral buffered formalin ...
-
No products found
because this supplier's products are not listed.
Lina Marcela Carmona, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 2 wells of 10 pg of Mouse Whole Brain Total RNA (Zyagen, MR-201) and 2 wells of 10 pg Control RNA provided in the Takara kit.
-
No products found
because this supplier's products are not listed.
Nikolaos Skartsis, et al.,
bioRxiv - Immunology 2021
Quote:
... CD28 superagonist (CD28SA) (5μg/mL; clone anti-CD28.1; Ancell, Stillwater, MN) were used to stimulate the T cells.
-
No products found
because this supplier's products are not listed.
Nigel S. Michki, et al.,
bioRxiv - Immunology 2022
Quote:
... Resulting fragmented DNA underwent size selection for fragments approximately 100-250 bp in length using SPRI beads (MagBio Genomics) and were subsequently subjected to bisulfite conversion using the EZ DNA Methylation-Lightning Kit (Zymo Research) ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Miner Deng, et al.,
bioRxiv - Microbiology 2023
Quote:
... and Sporo-Glo (Waterborne, 1:20) for 60 min ...
-
Superoxide Dismutase (SOD) is an oxidoreductase that catalyzes the reaction between superoxide...
Cat# PBCA1007,
Inquiry
Ask
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pseudovirus (an HIV-based luciferase expressing lentivirus pseudotyped with SARS-CoV-2 full length S protein) was obtained from Creative Biogene. One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Masataka Nakayama, Shigeru Kyuwa,
bioRxiv - Microbiology 2021
Quote:
... Each cage was filled with approximately 1,000 mL bedding (ALPHA-dri; Shepherd Specialty Papers, Watertown, TN, USA). To avoid artificial transmission of MHV ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Stephen D. Carter, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The bead suspension was made by a 1:1 dilution of 500 nm blue (345/435 nm) polystyrene fluorospheres (Phosphorex) with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Patrick M. Nolan, et al.,
bioRxiv - Physiology 2022
Quote:
... according to kit instructions (Assaypro cat no EC3001-1) at a 1/20 dilution ...
-
No products found
because this supplier's products are not listed.
Lee Dolat, Raphael H. Valdivia,
bioRxiv - Cell Biology 2020
Quote:
... The tissue was washed three times with cold PBS and mechanically disrupted by shaking in cold 10 mL PBS containing 0.1% bovine serum albumin (BSA; Fraction V, Equitech-Bio) for 1 min ...
-
No products found
because this supplier's products are not listed.
Freddyson J. Martínez-Rivera, et al.,
bioRxiv - Neuroscience 2024
Quote:
... NH) connected to a cannula (C313G-5UP; Plastic 1, VA / Protech International, TX) with a mesh (McMaster-Carr ...