-
No products found
because this supplier's products are not listed.
Stijn De Munter, et al.,
bioRxiv - Immunology 2023
Quote:
... 10 μM Rho-associated coiled–coil containing protein kinase (ROCK) inhibitor Y-27632 (Abmole) and 5 μM A83-01 (Tocris Bioscience)) ...
-
No products found
because this supplier's products are not listed.
Karine Queiroz Zetune Villa Real, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and residual IgG1 were further removed by incubating the pooled sample with agarose beads conjugated with anti-llama light chain (Capralogics).
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Charles B. Reilly, et al.,
bioRxiv - Microbiology 2024
Quote:
... B.1.617.2 (delta) and B.1.1.28 (gamma)) were obtained from Cellecta Inc and B.1.529 (omicron ...
-
No products found
because this supplier's products are not listed.
Leticia R. Q. Souza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the primary antibodies [Non-structural protein 1 from ZIKV (NS1, 1:500, BioFront Technologies, BF1225-06;), Class III β-tubulin (TuJ3 ...
-
No products found
because this supplier's products are not listed.
Darryl A. Wesener, et al.,
bioRxiv - Microbiology 2020
Quote:
... Diets were sterilized by gamma irradiation (20-50 kilogreys, Steris, Mentor, OH). Sterility was confirmed by culturing material in TYG medium under aerobic and anaerobic conditions ...
-
No products found
because this supplier's products are not listed.
Shintaroh Kubo, et al.,
bioRxiv - Biophysics 2022
Quote:
... the polarity of microtubules used here was determined by observing movement of DY-647-maleimide (Dyomics) labeled murine Kinesin-1 recombinant dimer (Shima et al. ...
-
No products found
because this supplier's products are not listed.
Michelle Wintzinger, et al.,
bioRxiv - Physiology 2022
Quote:
... we followed general guidelines associated with the staining assay #KTMTR2LT (StatLab; McKinney, TX). Briefly ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... and the population of microtubule tubulin modified by detyrosination (deTyr-tubulin; 31-1335-00, clone RM444, RevMAb Biosciences USA, Inc.). Sarcomeric actin was decorated with phalloidin conjugated to Alexa Fluor 633 (A22284 ...
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and then incubated with 150 μl of FLAG elution buffer (FLAG wash buffer 2 with 1 mg/ml 3×FLAG peptide [Protein Ark, GEN-3XFLAG-25]) overnight ...
-
No products found
because this supplier's products are not listed.
Benjamin J. Parker, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and the aphid lines belonged to two biotypes (associated with the host plants Trifolium pretense or Medicago sativa). Six Regiella strains were established in each of the six host genotypes as described above (except for three combinations which failed) ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Mohamad Ibrahim Cheikh, et al.,
bioRxiv - Biophysics 2022
Quote:
... plates were covered in light halocarbon oil (Halocarbon Oil 27, Sigma). Embryos with a distinctive faint halo in the periphery ...
-
No products found
because this supplier's products are not listed.
Matheus F. Sathler, et al.,
bioRxiv - Neuroscience 2022
Quote:
... NIH: HIV-1 IIIB gp120 Recombinant Protein from ImmunoDX, LLC ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Andrew S. Flies, et al.,
bioRxiv - Immunology 2020
Quote:
... Digested proteins in PBS were diluted 1:1 in Squalvax (Oz Biosciences # SQ0010) to a final concentration of 0.1 μg/μL and was mixed using interlocked syringes to form an emulsion ...
-
No products found
because this supplier's products are not listed.
Hsiao-Wei Tsao, et al.,
bioRxiv - Immunology 2021
Quote:
... The following primary antibodies were used to detect designated proteins: Batf (Brookwood Biomedical, PAB4003), Irf4 (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
Chuan Xu, et al.,
bioRxiv - Immunology 2023
Quote:
Rabbit polyclonal antibodies against human or murine IFNε proteins were generated by using peptides derived from IFNε protein sequences (Lampire Biological Laboratories (Pipersville, PA). The specificity of antibodies was determined by western blot analysis ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Verica Vasić, et al.,
bioRxiv - Neuroscience 2022
Quote:
... As primary antibody a polyclonal rabbit anti-human EGFL7 antibody (1:50, ReliaTech GmbH) was applied ...
-
No products found
because this supplier's products are not listed.
Markus W. Löffler, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Cell cultures were periodically tested for mycoplasma using commercially available polymerase chain reaction (PCR) kits (Minerva Biolabs, Berlin, Germany).
-
No products found
because this supplier's products are not listed.
Steve Sweet, et al.,
bioRxiv - Cancer Biology 2022
Quote:
All peptides were synthesized as light and heavy pairs by 21st Century Biochemicals (Marlborough, MA). Heavy peptides were labeled with C-terminal R [13C615N4] or K [13C615N2] with >99% isotopic enrichment ...
-
No products found
because this supplier's products are not listed.
M.M. Joglekar, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... VCAN (1:200, Mouse Anti-Versican Antibody 2B1, Seikagaku), and ELN (1:400 ...
-
No products found
because this supplier's products are not listed.
Li S. Xu, et al.,
bioRxiv - Immunology 2022
Quote:
... Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) was performed using SensiMix SYBR No-Rox master mix (Froggabio, Toronto, Canada) on a QuantStudio5 instrument (Applied biosystems ...
-
No products found
because this supplier's products are not listed.
Leila Feiz, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Immunodetection of the maize DELLA proteins was performed using anti-SLR1 primary antibody (Cosmo Bio USA, Carlsbad, California) (2:10,000 ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Alexandra Maslennikova, et al.,
bioRxiv - Microbiology 2021
Quote:
The levels of HIV-1 core protein Gag in cell supernatants were quantified using HIV-1 p24 ELISA Kit (Zeptometrix, Bufalo NY, USA) in accordance to the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... or anti-sheep secondary antibodies (1:2000 in PSBT + 4% milk powder, ImmunoReagents) as appropriate for 45 mins at room temperature ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kristine Farmen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The primary antibody used was pneumococcal serotype 4 anti-capsule (SSI Diagnostica, 1:250), secondary antibody used was Alexa Fluor 620 (1:1000) ...
-
Mouse monoclonal antibody specific for Dengue membrane, virus type 1, 2 and 3
Cat# MAB12182-500,
500µg USD $762.6
Ask
Mathieu Ferrari, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were washed with 0.05% v/v PBS-Tween and sequentially incubated with mouse anti-SARS-CoV-2 N protein antibody (The Native Antigen Company – MAB12183-100) at 1:500 dilution and HRP-conjugated goat anti-mouse IgG antibody (Jackson ImmunoResearch – 115-035-146 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Petra Kangas, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For depletion of the most abundant proteins from CSF ProteoSpin Abundant Serum Protein depletion kit (Norgen Biotek) was used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Christoph Giez, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Primary antibodies used in this study were: anti-GFP (Biozol, cat# GFP-1010, 1:1000 dilution) and anti-FMRFamid (BMA Biomedicals, cat# T-4322, 1:1000 dilution). After the primary antibody incubation ...
-
No products found
because this supplier's products are not listed.
Alexander Popov, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The sections were incubated for 48 hours in monoclonal (clone 3C12) mouse anti-Ezrin antibodies (1:100, Diagnostic BioSystems, Pleasanton ...
-
No products found
because this supplier's products are not listed.
Marion Le Rochais, et al.,
bioRxiv - Immunology 2022
Quote:
... tissues were incubated with a secondary antibody coupled to horseradish peroxidase (Polink-1 HRP for Rabbit & Mouse – GBI Labs Kit / AffiniPure Goat Anti-Rat IgG −112-005-143 ...
-
No products found
because this supplier's products are not listed.
Reza Nouri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... LwaCas13a proteins were purchased from MCLAB (cat# CAS13a-100). Cas13a and crRNA were mixed in 1×PBS to form the non-activated Cas13a/crRNA at room temperature for 20 min and stored at -80°C ...
-
Microtubule-associated protein 1A (806-814) is a fragment of MAP1A. Microtubule-associated...
Cat# BAT-009423,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Megha Subramanian, et al.,
bioRxiv - Genomics 2022
Quote:
... TTR protein levels were measured with mouse prealbumin kit from ALPCO, 41-PALMS-E01 (serum diluted 1:4000) ...
-
No products found
because this supplier's products are not listed.
Beatriz Gil, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Recombinant alpha- synuclein protein was a gift from rPeptide (GA, USA).
-
No products found
because this supplier's products are not listed.
David S. Yang, et al.,
bioRxiv - Biophysics 2020
Quote:
... Protein and incubation buffer were filtered with 0.22 μm Polyethersulfone (PES) (CELLTREAT Scientific Products, 229746) syringe filters ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-luciferin potassium salt (Prolume). The neutralization half-maximal inhibitory dilution (IC50 ...
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...