-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Paula Rodrigues de Almeida, et al.,
bioRxiv - Microbiology 2019
Quote:
Monoclonal antibody against ZIKV Non-Structural 1 (NS1) protein (Arigo Biolaboratories, Taiwan, Republic of China) was diluted 1:1000 in (PBS ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... hFIX protein was detected by a goat-anti-hFIX antibody (1:2000; Affinity Biologicals, GAFIX-AP). Mouse-anti-β-actin antibody (1:5000 ...
-
No products found
because this supplier's products are not listed.
Robert Horvath, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
We identified TE polymorphisms significantly associated with environmental factors using genome-environment association analyses (GEA) following Minadakis et al ...
-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Charles Winterhalter, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Reaction tubes were then transferred on ice and exposed to 365 nm wavelength light in a UV oven for 1 minute (∼400 mJ, Boekel #234100). A loading dye (4X SDS-page ...
-
No products found
because this supplier's products are not listed.
Fabian S. F. Hartmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
White light images were captured using the Phenobooth (Singer Instruments, United Kingdom). If required ...
-
No products found
because this supplier's products are not listed.
Stephan Brouwer, et al.,
bioRxiv - Microbiology 2020
Quote:
... The primary antibodies used for the detection of SpeC and SSA protein in GAS culture supernatants were rabbit antibody to SpeC (PCI333, Toxin Technology; 1:1,000 dilution) and affinity-purified rabbit antibody to SSA (produced by Mimotopes ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Richard C. Chang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Chromatin samples were prepared by sonicating in 0.5 mL thin-walled polymerase chain reaction tubes (BrandTech, CT) using a QSonica Q800R2 (QSonica ...
-
No products found
because this supplier's products are not listed.
Yanan Lyu, et al.,
bioRxiv - Neuroscience 2022
Quote:
3-morpholinosydnonimine(SIN-1) was purchased from Focus Biomolecules(Plymouth Meeting, PA USA). It could spontaneously release nitric oxide(NO ...
-
No products found
because this supplier's products are not listed.
HR Holmes, et al.,
bioRxiv - Bioengineering 2024
Quote:
... we diluted samples of gamma-irradiated SARS-CoV-2 virus isolate USA-WA1/2020 (BEI #NR-52287) in human nasal wash (Lee Biosolutions #991-26-P) which were used as reference samples ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Lukas B. Krone, et al.,
bioRxiv - Neuroscience 2020
Quote:
... which were placed in sound-attenuated and light-controlled Faraday chambers (Campden Instruments, Loughborough, UK), with each chamber fitting two cages ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... specimens were diluted 1:1 using a PBS-based Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide.
-
No products found
because this supplier's products are not listed.
Naba Al-Sari, et al.,
bioRxiv - Biophysics 2020
Quote:
... 1-Palmitoyl-2-Hydroxy-sn-Glycero-3-Phosphatidylcholine (LPC(16:0)) was purchased from Larodan and 1-hexadecyl-2-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (PC(16:0e/18:1(9Z))) ...
-
No products found
because this supplier's products are not listed.
Marie FA Cutiongco, et al.,
bioRxiv - Bioengineering 2020
Quote:
... SPP1 and ALPL was determined using 5 ng of total RNA and a one-step SYBR-based quantitative polymerase chain reaction kit (PrimerDesign). Gene expression assays were run on a BioRad CFX96 platform ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
JH Larsen, et al.,
bioRxiv - Pathology 2023
Quote:
... using primary antibodies BS66 (BSH-7459-100, Nordic Biosite, 1:1000), SMMS-1 (M3558 ...
-
No products found
because this supplier's products are not listed.
Amanda P. Waller, et al.,
bioRxiv - Pathology 2020
Quote:
... ELISA and immunoblot antibodies were validated using species-specific positive (purified species-specific protein; Haematologic Technologies, Inc, Essex Juntion, VT) and non-specific protein negative controls ...
-
siRNA to inhibit MAP1LC3C expression using RNA interference
Cat# CRJ8266,
15 nmol USD $340.0, 30 nmol USD $510.0
Ask
Adam R. Bentham, et al.,
bioRxiv - Plant Biology 2023
Quote:
... SDS-PAGE/immunoblot analysis was used to identify proteins in the sample with use of anti-GFP antibody (Cohesion Biosciences) and anti-mRFP antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Han-Wei Shih, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1:200 diluted Alexa 647-conjugated anti-CWP1 antibody (Waterborne, New Orleans, LA) was added to incubate for 1 h ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
... Blocking solution (sciBLOCK Protein D1M solution, Scienion) was added at 200 μL/well with a multichannel pipet and allowed to incubate without agitation for 1 hour ...
-
No products found
because this supplier's products are not listed.
Ping Lv, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The primary antibodies included TMOD4 antibody (CUSABIO, China, CSB-PA609953ESR2HU); HuR antibody (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Paulus Mrass, et al.,
bioRxiv - Immunology 2022
Quote:
... We used the following antibodies: H3N2 virion antibody (ViroStat, Cat#: 1317); anti-mouse CD107A ...
-
No products found
because this supplier's products are not listed.
Mackenzie E. Ryan, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein sequence alignments were performed using MegAlign Pro (DNAstar). Superimposed images of protein structures were generated using ChimeraX Matchmaker84 ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Deborah L. Gater, et al.,
bioRxiv - Biophysics 2022
Quote:
... Vitamin D binding protein (DBP) was purchased from Athens Research and Vitamin D Binding protein (VDR ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
Cat# AB-11,
100 microliters,USD $400.0
Ask
Michelle Dookwah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Anti-p75 antibody (Advanced Targeting Systems, # AB-N07), 1:100 dilution in PBS-T ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... we grew parasites at 37°C in vitro at 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, VA or BioIVT, NY) in RPMI 1640 medium (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Marissa Saenz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Following precipitation of plasma proteins with acetonitrile containing 3.5 ng/mL buprenorphine-d4 (Cerilliant, Round Rock, TX, USA) as an internal standard ...
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Takumi Kitamoto, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... GLP-1 concentrations were determined by mouse GLP-1 ELISA Kit (Crystal Chem). mGOs were lysed in CelLytic™ M (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Celine Everaert, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and 1 µl reaction buffer (ArcticZymes 66001). Of the resulting volume ...