-
No products found
because this supplier's products are not listed.
Miglė Kišonaitė, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Boc-L-R-R-AMC (trypsin-like activity) and Z-L-L-E-AMC (caspase-like activity) (Boston Biochem). The proteasome samples were incubated with 50 μM AMC-peptide in the respective purification buffers (standard or the exogenous nucleotide depleted buffer ...
-
Lenti/Retro virus
Cat# KC30796,
ViroMag RL 200µl + Magnetic Plate MF96000, USD $654.00/KIT
Ask
Elena Vendrame, et al.,
bioRxiv - Immunology 2019
Quote:
... CD4+ T cells were infected overnight with Q23-FL via ViroMag R/L magnetofection (Oz Biosciences) at a multiplicity of infection of 20 ...
-
No products found
because this supplier's products are not listed.
Christopher W. Thomas, et al.,
bioRxiv - Neuroscience 2021
Quote:
Psilocin (4-hydroxy-N,N-dimethyltryptamine, LGC Standards) was administered by intraperitoneal injection at a dose of 2 mg/kg ...
-
No products found
because this supplier's products are not listed.
Victoria A Toomajian, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mixed with DI H2O and RunBlue LDS sample buffer (4X) (Expedeon, NXB31010). The cell lysate mixtures were heated at 70°C for 10 min ...
-
No products found
Courtney J. Mycroft-West, et al.,
bioRxiv - Biochemistry 2019
Quote:
... pelagicus extract was dialysed against distilled H2O (3.5 kDa MWCO membrane; Biodesign, USA) for 48 hours prior to syringe filtration (0.2 µm ...
-
No products found
because this supplier's products are not listed.
Tural Aksel, et al.,
bioRxiv - Bioengineering 2022
Quote:
Recombinant ubiquitin with N-terminal Histag (BPS Biosciences, P/N: 79293) and Alexa647-proteinA conjugate (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ALIX (1:1000, Biorbyt, Cat. N. orb235075), CD9 (1:500 ...
-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
No products found
because this supplier's products are not listed.
Melissa Bredow, et al.,
bioRxiv - Plant Biology 2020
Quote:
AtPep1(99) and elf18 (100) used for immune assays were synthesized by EZBiolab (USA). AtPep1-induced SGI and ROS burst assays were performed as previously described (101) ...
-
No products found
because this supplier's products are not listed.
Marc Ramos-Llorens, et al.,
bioRxiv - Biochemistry 2024
Quote:
... All FA substrates (>98–99% pure) used for the functional characterisation assays were obtained from Nu-Chek Prep, Inc ...
-
No products found
because this supplier's products are not listed.
Konstantinos Kotsaridis, et al.,
bioRxiv - Microbiology 2022
Quote:
... L-methionyl-arginyol-phenylalanylalanine acetate H2O (MRFA, Research Plus, Barnegat, NJ), and perfluoroalkyl triazine (Ultramark 1621 ...
-
No products found
because this supplier's products are not listed.
Atul Rangadurai, et al.,
bioRxiv - Biophysics 2021
Quote:
... UltraMild DNA phosphoramidites (T, n-pac-C, n-tbpac-G, n-pac-A, n-fmoc-m1A) and Ultramild Cap A (Glen Research), and columns (1000 Å from Bioautomation ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Vanessa M. Doulames, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a subset of rats (n=10) were retrograde traced with Fluorogold (Fluorochrome, 2% solution in sterile distilled H2O). Briefly ...
-
No products found
because this supplier's products are not listed.
John C Zinder, et al.,
bioRxiv - Biochemistry 2022
Quote:
... was dissolved in LC-MS grade H2O (Proteochem, LC6330) at 50 mM and added to POT1/TPP1/GFP prepared at 1 mg/mL in NHS-ester non-reactive buffer to the final concentration of 0.35-0.75 mM ...
-
No products found
because this supplier's products are not listed.
David M. Anderson, et al.,
bioRxiv - Microbiology 2023
Quote:
... N-(acid-PEG10)-N-bis(PEG10-azide) (2803119-06-2, Broadpharm), β-Lactose-PEG3-azide (246855-74-3 ...
-
No products found
because this supplier's products are not listed.
James Brett Case, et al.,
bioRxiv - Microbiology 2020
Quote:
... in H2O and viewed on a JEOL 1200 EX transmission electron microscope (JEOL USA Inc.) equipped with an AMT 8-megapixel digital camera and AMT Image Capture Engine V602 software (Advanced Microscopy Techniques).
-
Recombinant Antigen
Cat# REC31701-100,
100µg USD $488.0
Ask
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... N (The Native Antigen Company, REC31812), SARS-CoV S (produced in house) ...
-
No products found
because this supplier's products are not listed.
Grant R. Kolar, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Tissue sections were washed twice with diethyl pyrocarbonate (DEPC)-treated water (DEPC H2O) and incubated in 1:2,000 diluted fiducials (Bangs Laboratory) in 2X SSCT (2X saline sodium citrate ...
-
No products found
because this supplier's products are not listed.
Hirak Saxena, et al.,
bioRxiv - Microbiology 2023
Quote:
All strains were grown in 2YT media (16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl, BioShop Canada). NEB® Stable E ...
-
No products found
because this supplier's products are not listed.
Zibin Zhou, et al.,
bioRxiv - Biochemistry 2023
Quote:
... anti-pS/T (ECM Biosciences, PP2551, New Jersey, USA), anti-PKM2 (CST ...
-
No products found
because this supplier's products are not listed.
Marvin Reich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and cathepsin L (Abnova, KA0770) were performed according to the manufacturer’s instructions using samples with normalized protein concentrations ...
-
No products found
because this supplier's products are not listed.
Yudong Guan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A2F N-glycan standards were obtained from QA-Bio. Two different batches of EPOs (epoetin beta ...
-
No products found
because this supplier's products are not listed.
Pierre Santucci, et al.,
bioRxiv - Microbiology 2020
Quote:
... whereas wells containing 5 mg/L or 2.5 mg/L of RIF (LKT laboratories, R3220) and BDQ (MedChemExpress ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... cells were seeded into multi-well plates and transfected with polyethyleneimine (PEI, 1 mg/ml in H2O, pH 7, Polyscience, catalog no. 23966-1). Therefore ...
-
No products found
because this supplier's products are not listed.
Geoffrey M.W. Cook, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was acetylated with acetic acid N-hydroxysuccinimide ester (Apollo Scientific) as described64 and the product shown to be homogeneous by thin layer chromatography ...
-
No products found
Alexander J. Ehrenberg, et al.,
bioRxiv - Pathology 2019
Quote:
... goat-anti-guinea pig IgG (H+L) – (R-05076, Advansta, or goat-anti-Rabbit IgG (H+L)-R-05072 ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were grown in 1 L of media in 1 L spinner flasks (Bellco, SKU: 1965-61010). 48 hours after spinfection with the genome-wide library ...
-
No products found
because this supplier's products are not listed.
Franziska Blaeschke, et al.,
bioRxiv - Immunology 2022
Quote:
... T cells were incubated with NY-ESO-1 specific dextramer (Immudex) for 12 min at RT (1:50 dilution) ...
-
No products found
because this supplier's products are not listed.
Yingli Gu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 0.1% Poly-L- Lysine (Cultrex® Poly-L-Lysine) was from Trevigen (Gaithersburg, MD; Cat# 3438-100-01). Mouse NGF was purified from submaxillary glands as described previously94 ...
-
No products found
because this supplier's products are not listed.
Trupti Shetty, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-methyl protoporphyrin (NMPP) was purchased from Frontier Scientific (Logan, Utah, USA) and prepared in DMSO ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... T cells were frozen in Bambanker Cell Freezing Media (Bulldog Bio Inc, BB01) and stored in liquid nitrogen until use ...
-
No products found
because this supplier's products are not listed.
Silvio D. Brugger, et al.,
bioRxiv - Microbiology 2020
Quote:
... The overnight culture was then inoculated at 1:25 into fresh BHI broth and grown for 24 hrs at 37°C prior to measuring the lactic acid concentration (mmol/L) using a D-lactic acid/L-lactic acid kit per the manufacturer’s instructions (Cat. no. 11112821035, R-Biopharm AG).
-
No products found
because this supplier's products are not listed.
Mitsuhiro Matsuda, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Signals were detected by N-Histofine® DAB-3S kit (Nichirei Bioscience Inc.). Details of used antibodies are listed in Extended Data Table 6.
-
No products found
because this supplier's products are not listed.
Matthew S. Yorek, et al.,
bioRxiv - Microbiology 2019
Quote:
... HV or analytical column through a microcross assembly (IDEX, P/N UH-752). Peptides are desalted on the trap using 16μl mobile phase A for 4 min ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Following secondary antibodies were used: monoclonal N- and S- specific IgG antibodies (Hytest, rabbit IgG ...
-
No products found
because this supplier's products are not listed.
You Wu, Tam L. Ngyuen, Carrie E. Perlman,
bioRxiv - Physiology 2020
Quote:
... apply a vascular clamp (S&T B1-V, Fine Science Tools, Foster City, CA) between the right middle and caudal lobes and separate the caudal lobe distal to the clamp ...
-
No products found
because this supplier's products are not listed.
Rajendra Karki, et al.,
bioRxiv - Immunology 2020
Quote:
... or 500 μg of neutralizing antibody against TNF-α (Leinco Technologies, Inc., T-703) plus 500 μg of neutralizing antibody against IFN-γ (Leinco Technologies ...
-
No products found
because this supplier's products are not listed.
Heesun Kim, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... transferred to Poly-L-lysine coated slides (Labscientific, 7799) and mounted with 10 μl of SlowFade Diamond Antifade Mountant with DAPI (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Melisa Lázaro, et al.,
bioRxiv - Microbiology 2020
Quote:
... This was confirmed by labeling N-terminally His6-tagged mL-GDH180 with Ni-NTA-Nanogold (Nanoprobes) and visualizing particles by negative staining electron microscopy ...
-
No products found
because this supplier's products are not listed.
Juliet Mwirigi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cells were plated onto Poly-L-Lysine coated E-plates (ACEA Biosciences) in low serum medium (5% FBS ...
-
No products found
because this supplier's products are not listed.
M.R. Farrell, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Separate animals (n = 8) were trained to respond for 45 mg chow pellets (Bio-Serv, Ct # F0165) instead using the same procedures ...
-
No products found
because this supplier's products are not listed.
Danielle J. Sisnett, et al.,
bioRxiv - Immunology 2023
Quote:
... and normal healthy endometrium (n=9) using a total RNA purification kit (17200, Norgen Biotek Corp., Canada) as per manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
K.G. Daniels, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... T cells were cryopreserved in RPMI1640 (UCSF cell culture core) with 20% human AB serum (Valley Biomedical, #HP1022HI) and 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Gadisti Aisha Mohamed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Slides were washed in TBS + 0.1% tween (TBS-T) and blocked in Antibody Diluent/Block (Akoya Biosciences, ARD1001EA) for 30 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Boyang Zhao, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and σNS-ΔN17 were subcloned into the bacterial expression vector pET28 with an N-terminal His tag and a TEV protease cleavage site (Epoch Life Science). Escherichia coli DE3 cells (Novagen ...
-
No products found
because this supplier's products are not listed.
Lamiaa El-Shennawy, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with EM goat anti-mouse IgG (H&L) 10 nm gold conjugated (BBI solutions, EM.GMHL10) (7:100 ...
-
No products found
because this supplier's products are not listed.
Kimberly S. Collins, et al.,
bioRxiv - Systems Biology 2021
Quote:
... samples of background control and db mice (n = 5 per group) were prepared using the automated MicroLab STAR® system (Hamilton Company, Reno, NV). Metabolomic analysis was performed at Metabolon Inc ...