Labshake search
Citations for Tib Molbiol :
1 - 3 of 3 citations for L Leucine N T Boc H2O 13C6 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... or synthesized by the GMP & T Cell Therapy Unit at German Cancer Research Center (DKFZ; Heidelberg, Germany) and 20 µg CpG ODN 1826 (TIB MolBiol) suspended in 20 µl PBS ...
-
bioRxiv - Immunology 2023Quote: ... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...