-
No products found
because this supplier's products are not listed.
Miwa Umebayashi, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Methyl beta cyclodextrin was purchased from CycloLab. Cholesterol-water soluble ...
-
No products found
because this supplier's products are not listed.
Julia Hansen, et al.,
bioRxiv - Microbiology 2022
Quote:
... ethyl-[R]-cysteinyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysine(ε-aminocaproyl-∈-aminocaproyl-biotinyl) x 3 CF3COOH (EMC Microcollections, Tübingen, Germany) at 1.5 mg/ml in carbonate buffer (pH 9.2 ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... a N6-Methyl-A-CE phosphoramidite from Glen Research was utilized ...
-
No products found
because this supplier's products are not listed.
Emily S. Norton, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... lysates were clicked to 10 μM DBCO-S-S-PEG3-biotin (BroadPharm) for 6 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Muhammad Rizwan, et al.,
bioRxiv - Bioengineering 2022
Quote:
... methyl cellulose dialysis membrane 12-14 kDa cut-off (Spectrum Laboratories), Jag1 (188-204 (Cedarlane Labs) ...
-
No products found
because this supplier's products are not listed.
Olga Yu. Shagaleeva, et al.,
bioRxiv - Microbiology 2024
Quote:
... USA). O-methyl hydroxylamine hydrochloride (purity: 98.0%; lot no. 542171) was purchased from J&K Scientific Ltd ...
-
No products found
because this supplier's products are not listed.
Gongliang Zhang, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The amount of S-adenosyl homocysteine (SAH; CisBio) produced was determined using a standard curve and a linear back-calculation method ...
-
No products found
because this supplier's products are not listed.
Patricia C. Lopes, Robert de Bruijn,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer, Benchmark Scientific), followed by a 5□min rest period ...
-
Carbohydrate
Cat# GMS0185S,
Inquiry
Ask
Susanne Rauch, et al.,
bioRxiv - Immunology 2021
Quote:
... Specific S protein expression was assessed via staining with Human anti SARS CoV S antibody (CR3022) (Creative Biolabs, Cat. MRO-1214LC) followed by goat anti-human IgG F(ab’)2 fragment PE antibody (Immuno Research ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Luca Carta, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The membrane was stained with Ponceau S Stain (Boston BioProducts) to verify uniform protein loading ...
-
No products found
because this supplier's products are not listed.
Anne-Catherine Fluckiger, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant SARS-COV-2 S(S1+S2) unmodified protein (Mybiosource) or SARS-CoV-2 stabilized prefusion S protein (National Research Council of Canada -NRC ...
-
PureCol®-S is a 3 mg/ml, type I bovine atelocollagen solution to use as a collagen standard....
Cat# 5015-20ML,
20 mL, USD $255.0
Ask
Jessie J.-Y. Chang, et al.,
bioRxiv - Immunology 2023
Quote:
... pre-coated with PureCol-S collagen type I (Advanced BioMatrix). The cells were incubated at 37°C and 5% v/v CO2 until confluency in PneumaCultTM-ExPlus media (STEMCELL Technologies ...
-
No products found
because this supplier's products are not listed.
Ulrika Simone Spangsberg Petersen, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... All SSOs used are RNA oligonucleotides with 2’-O-methyl modifications and phosphorothioate backbones (LGC Biosearch Technologies; Risskov, Denmark) (Table S2) ...
-
No products found
because this supplier's products are not listed.
Sonali Jindal, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... followed by chemiluminescent substrate (Protein Simple # PS-CS01, Luminol-S, Peroxide). Protein separation and signal detection utilized the WES system (Protein Simple ...
-
No products found
because this supplier's products are not listed.
Iulia Rusu, et al.,
bioRxiv - Immunology 2021
Quote:
... InVivoMAb Armenian hamster IgG isotype control anti-glutathione S-transferase (BioXcell #BE0260) was used as a negative control.
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... The reaction was developed with TMB one (Kementec Solutions A/S, Demark) as a peroxidase substrate and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... The positive control (anti-S IgG) was obtained from Abeomics (CA, USA).
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Kimberly L. P. Long, et al.,
bioRxiv - Neuroscience 2021
Quote:
... rabbit anti-glutathione S-transferase π (GSTπ; 1:1000; MBL International, Woburn, MA), sheep anti-carbonic anhydrase II (CAII ...
-
No products found
because this supplier's products are not listed.
Saber H. Saber, et al.,
bioRxiv - Neuroscience 2024
Quote:
... we diluted anti-GFP Atto647N nanobodies (Synaptic Systems, cat. no. N0301-At647N-S) to final concentration of 100 pM in low K+ or high K+ buffer ...
-
No products found
because this supplier's products are not listed.
Adam C. Farsheed, et al.,
bioRxiv - Bioengineering 2024
Quote:
2D SAXS was performed using a Rigaku S-MAX 3000 (Rigaku, Tokyo, Japan) at the University of Houston within the lab of Dr ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Following secondary antibodies were used: monoclonal N- and S- specific IgG antibodies (Hytest, rabbit IgG ...
-
No products found
because this supplier's products are not listed.
Laura Di Patria, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MMP2 activity was evaluated by a colorimetric assay using Ac-Pro-Leu-Gly-[2-mercapto-4-methyl-pentanoyl]-Leu-Gly-OC2H5 thiopeptide (50 µM; BioMol International, Hamburg, Germany) in 50 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Alice Cho, et al.,
bioRxiv - Immunology 2021
Quote:
... coli BL21 (DE3) pLys S cells with pOpen Taw plasmid (Gene and Cell Technologies) and induing the culture overnight with 1 mM IPTG ...
-
No products found
because this supplier's products are not listed.
Jay M. McKinney, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and 100 μg/mL penicillin/streptomycin (P/S; B21110; Atlanta Biologicals, Lawrenceville, GA, USA), and subcultured at 80% confluency ...
-
No products found
because this supplier's products are not listed.
Rachel C. Clary, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TdTomato fluorescence was collected with a GaAsP photomultiplier tube (Scientifica, S-MDU-PMT-50-65) and green fluorescence was collected with a raw PMT (Scientifica ...
-
No products found
because this supplier's products are not listed.
Corinne Hutfilz,
bioRxiv - Genomics 2023
Quote:
... standard conditions with 10 μL S-methoprene (39.4 mm, AK Scientific, effective dose 0.1 μg) added every 2 days ...
-
No products found
because this supplier's products are not listed.
Matthew R Detter, et al.,
bioRxiv - Genetics 2020
Quote:
... vitamin D3 (25 IU/g in the chow, Envigo Teklad diet ...
-
No products found
because this supplier's products are not listed.
Adrian S. Monthony, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The shoot proliferation medium (hereafter referred to as LT-S) consisted of MS (M524; Phytotechnology Laboratories) nutrients ...
-
No products found
because this supplier's products are not listed.
Sandeep Surendra Panikar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified mAbs was then reacted with a 20-fold molar excess of 2-S-(4-Isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn-NOTA, Macrocyclics) overnight at 4 °C with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Esther W. Lim, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 picomoles of D3-deoxysphinganine (Avanti, Croda International Plc, 860474), 200 picomoles of C15 ceramide-d7 (d18:1-d7/15:0 ...
-
No products found
because this supplier's products are not listed.
Gustavo Monnerat, et al.,
bioRxiv - Pathology 2019
Quote:
... Brazil) and D3-testosterone (ISTD) from LGC Standards (London, England). Amino acid quantification was carried out using a TSQ Quantiva from Thermo Scientific (San Jose ...
-
No products found
because this supplier's products are not listed.
The Nhu Nguyen, et al.,
bioRxiv - Microbiology 2023
Quote:
Antibody responses against IAV-S nucleoprotein (NP) were measured by using a commercial blocking ELISA (IDEXX, Montpellier, France), following the manufacturer’s recommendation ...
-
No products found
because this supplier's products are not listed.
SS Parker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
No products found
because this supplier's products are not listed.
Tingting Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... S1 and S proteins were subjected to HPLC (Waters; Milford, MA) analysis using a TSK Gel G5000PWXL7.8 × 300 mm column (TOSOH, Tokyo, Japan) equilibrated in PBS ...
-
No products found
because this supplier's products are not listed.
Yufei Xiang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The RBD (residues 319-541) of the SARS-Cov-2 S protein was expressed as a secreted protein in Spodoptera frugiperda Sf9 cells (Expression Systems) using the Bac-to-bac baculovirus method (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Ejaz Hussain, et al.,
bioRxiv - Plant Biology 2021
Quote:
Seeds were sown on F2 + S Levington Advance Seed and Modular Compost plus Sand soil mix (ICL Specialty Fertilizers, Suffolk, U.K.) and stratified for four days in darkness at 4 ºC ...
-
No products found
because this supplier's products are not listed.
Zhou Chen, et al.,
bioRxiv - Biophysics 2022
Quote:
... and supplemented with 1% (w/v) glycol-diosgenin (GDN) and rotated on an Orbitron rotator II (speed mode S) (Boekel Scientific) at 4°C for 2 h ...
-
No products found
because this supplier's products are not listed.
Hugo G.J. Damstra, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 4-fold (R2-myc-his; a gift from S. Oliveira) molar excess of NHS-ester (ATTO 425, ATTO 647N; ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
David B. Kastner, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
No products found
because this supplier's products are not listed.
Francesco Manfredi, et al.,
bioRxiv - Immunology 2023
Quote:
... virus dilutions and number of deaths/group after challenge were used to calculate the LD50 (Quest Graph™ LD50 Calculator, AAT Bioquest, Inc., S. Francisco, CA, USA). When indicated ...
-
No products found
because this supplier's products are not listed.
Asta Lučiūnaitė, et al.,
bioRxiv - Immunology 2021
Quote:
... and FAM-FLICA® Caspase-1 Assay Kit (containing FLICA reagent FAM-YVAD-FMK – caspase-1 inhibitor probe; cat#98) were obtained from ImmunoChemistry Technologies. Dimethylsulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Sandor Spisak, et al.,
bioRxiv - Cancer Biology 2024
Quote:
(Cellecta #SVSHU6TEP-L-CT) was used for shRNA inducible knockdown in colon organoids ...
-
No products found
because this supplier's products are not listed.
Cristina Herencias, et al.,
bioRxiv - Microbiology 2023
Quote:
... tetracycline (15 mg/L, Nzytech), or chloramphenicol (30 mg/L ...
-
No products found
because this supplier's products are not listed.
Gwen Swinnen, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and 10 g/L of agar (Neogen) in Magenta boxes ...
-
No products found
because this supplier's products are not listed.
Katrina B. Velle, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were cultured axenically in M7 Media (10% FBS + 45 mg/L L-methionine + 5 g/L yeast extract + 5.4 g/L glucose + 2% (v/v) M7 Buffer (18.1 g/L KH2PO4 + 25 g/L Na2HPO4)) in plug seal tissue culture-treated flasks (CELLTREAT; cat. no. 229330) and grown at 28°C ...
-
No products found
because this supplier's products are not listed.
Samual C. Allgood, et al.,
bioRxiv - Microbiology 2023
Quote:
... glass-bottomed plates (Brooks Life Sciences catalog number MGB096-1-2-LG-L) at 37°C with 5% CO2 ...
-
No products found
Jacob P Matson, et al.,
bioRxiv - Cell Biology 2019
Quote:
... with 10% FBS and 2 mM L-glutamine in #1.5 glass bottom plates (Cellvis) in a humidified enclosure at 37° C with 5% CO2 ...