Labshake search
Citations for Charles River Labs :
1 - 4 of 4 citations for L Cysteine S Methyl S Methyl D3 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Biochemistry 2023Quote: Cortical neuron cultures were established from neonatal mouse brains (wild-type C57BL/6, Charles River, strain code 027, or the genotype(s) indicated for each experiment ...
-
bioRxiv - Neuroscience 2023Quote: ... PH was induced in 98 male Sprague-Dawley rats (5-7 weeks, 150-200g, Charles River) using either the Sugen-Hypoxia-Normoxia (SuHxNx ...
-
bioRxiv - Biophysics 2020Quote: ... a 100 µ l aliquot of the 2 mg/ml Influenza A/PR/8/34 virus stock (Charles River, CT, USA) was thawed at room temperature and diluted using 50 µ l isotonic 145 mM NaCl/50 mM HEPES (pH 7.4 ...