-
No products found
because this supplier's products are not listed.
Phaedra Winstanley-Zarach, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... control human articular cartilage tissue was obtained from Articular Engineering (Northbrook, IL). Six cartilage samples from each group were analysed and all were obtained from male donors ...
-
No products found
because this supplier's products are not listed.
Myung Chung, et al.,
bioRxiv - Neuroscience 2024
Quote:
... HEK293-EGFP (GenTarget, Cat. No. #SC001), and NIH-3T3 (originally obtained from Riken Bioresource Research Center and gifted from Dr ...
-
No products found
because this supplier's products are not listed.
Julia A Alvarez, et al.,
bioRxiv - Microbiology 2024
Quote:
... 20% heat inactivated (HI) fetal bovine serum (FBS) (Omega Scientific), 1% penicillin-streptomycin (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Emilie L. Cerezo, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Human EGF (Euromedex, Cat# HC88823), LJH685 (Selleck Chemicals ...
-
No products found
because this supplier's products are not listed.
Balaji Karthick Subramanian, et al.,
bioRxiv - Pathology 2019
Quote:
... Human primary podocytes from Celprogen Inc ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Lior Tal, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
No products found
because this supplier's products are not listed.
V. Praveen Chakravarthi, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 30 IU of human chorionic gonadotropin (hCG; BioVendor) was injected intraperitoneally ...
-
No products found
because this supplier's products are not listed.
Ida M. Modvig, et al.,
bioRxiv - Physiology 2019
Quote:
... Radioactive labeled rat and human secretin was obtained from Phoenix Pharmaceuticals, Inc (cat no ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant human interleukin-12 (IL-2) was gifted from Akron Biotech. Recombinant human interleukin-15 (IL-15 ...
-
No products found
because this supplier's products are not listed.
Justine Creff, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 200 µg for HEK293) were incubated with 3 µg of the indicated antibodies and 12 µL protein sepharose beads (IPA300, Repligen) at 4°C for 4 h ...
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... purified His-tagged ACE2 (EpiGentek) was added at a concentration of 100 ng/well (prepared with PBS ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... his-tagged YFV E protein (Meridian Life Science) was associated to the tips at 5 μg/mL for 60 sec ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant IL-17F.S65L and IL-17F were synthesized by Bon Opus Biosciences (Millburn, NJ) by expression in Expi293 cells (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Anil Verma, et al.,
bioRxiv - Immunology 2023
Quote:
... were labeled with biotinylated anti-His tag monoclonal antibody (ThermoScientific) and used to capture His-tagged clade C gp120 Du151 protein (Immune Technologies). The gp120-expressing beads were then incubated with triplicate 5-fold dilutions of heat-inactivated serum samples in V-bottom plates for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Joseph T. Clark, et al.,
bioRxiv - Immunology 2021
Quote:
... IL-33R (DJ8, MD Biosciences). For analysis of myeloid cells ...
-
No products found
because this supplier's products are not listed.
Kuan-Yi Lu, et al.,
bioRxiv - Microbiology 2020
Quote:
... LY303511 (Ark Pharm, Arlington Heights, IL), lapachol (Sigma) ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Saejeong Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HEK293 cells were washed with PBS and lysed in NP-40 lysis buffer (Boston Bioproducts) including protease and phosphatase inhibitor (Roche) ...
-
WB, IF,ELISA
Cat# A5199, SKU# A5199-20ul,
20ul, $47.00
Ask
Xuxiao He, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and Nickel Magnetic Beads for His tag protein purification (Bimake, B23602) according to the manufacturer’s protocol ...
-
WB, ELISA
Cat# CDC-41,
0.1 mg, Inquire
Ask
Ilaria Frasson, et al.,
bioRxiv - Microbiology 2023
Quote:
... We conducted genome-wide negative selection (dropout) screens in Cas9-Calu-3 cells by using the human GeCKO v2 library (Creative Biogene, cat. CCLV0001) that targets 18823 genes with 6 gRNAs/gene as well as 1000 non-targeting gRNAs ...
-
No products found
because this supplier's products are not listed.
Laith H Harb, et al.,
bioRxiv - Immunology 2021
Quote:
... dust-free bedding (Shepherd Specialty Papers, Chicago, IL, USA). Animals were housed under a 12-hour day/night cycle ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Alexa Schuettenberg, et al.,
bioRxiv - Immunology 2022
Quote:
... normal human IgG (ProSci #5503) on each plate as a positive control ...
-
No products found
because this supplier's products are not listed.
Tobias Tertel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 12 nM anti-human CD63 PE (EXBIO) or 13 nM anti-human CD81 PE (Beckman Coulter) ...
-
No products found
because this supplier's products are not listed.
Thi K. Tran-Nguyen,
bioRxiv - Molecular Biology 2021
Quote:
Recombinant human GRP78s purchased from StressMarq Biosciences or produced in the laboratory [30] were used as antigens in ELISA ...
-
No products found
because this supplier's products are not listed.
Nazila V. Jafari, Jennifer L. Rohn,
bioRxiv - Microbiology 2022
Quote:
HBLAK human bladder progenitor cells (CELLnTEC, Switzerland) were grown according to the CELLnTEC protocol ...
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 U APEX Taq (Genesee Scientific), and molecular-grade H2O to bring the total volume to 35 μl.
-
No products found
because this supplier's products are not listed.
Yuichi Mitsui, et al.,
bioRxiv - Immunology 2022
Quote:
Human PBMCs were purchased from Precision for Medicine, Inc ...
-
Interleukin-28A, His Tag Protein is a recombinant cytokine.
Cat# abx262418-1MG,
1 mg USD $7627.0
Ask
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
The following kits were used for the qualitative determination of IgG class antibodies against human coronaviruses: abx052609 Human Coronavirus IgG ELISA kit (Abbexa, Cambridge, UK), against an undetermined antigen ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Siyi Du, et al.,
bioRxiv - Bioengineering 2019
Quote:
... N-succinimidyliodoacetate (SIA), purchased from Pierce (Rockford, IL). Spectra/por® dialysis membrane (mol. wt. cut-off 50,000) was acquired from Spectrum Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...