-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Zhi Cheng, et al.,
bioRxiv - Biochemistry 2022
Quote:
... system was connected to a microtee connector (IDEX, IL). The microtee connector used 250 μm fused silica capillaries for both pathways ...
-
No products found
because this supplier's products are not listed.
Evelína Šťastná, et al.,
bioRxiv - Immunology 2023
Quote:
... and IL-17A standard (clone RP0128S-005, Kingfisher Biotech) was prepared following manufacturer’s instructions and used for making a log-transformed standard curve ...
-
No products found
because this supplier's products are not listed.
Shanshan Lang, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The recombinant extracellular domain of CD38 and PD-L1 was produced as a 6-His and AviTag™ fusion in HEK293 cells and purified by Ni-NTA followed by in vitro biotinylation by BirA biotin ligase (Avidity).
-
No products found
because this supplier's products are not listed.
Tracy J. Berg, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary human astrocytes (3H Biomedical) were cultured in Astrocyte Medium (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Ava P. Soleimany, et al.,
bioRxiv - Bioengineering 2020
Quote:
Fresh frozen human PCa TMAs (BioChain Institute, Inc.; T6235201) were air dried and fixed in ice-cold acetone for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Tommy Tong, et al.,
bioRxiv - Immunology 2023
Quote:
... followed by anti-human IgG AP conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
The Human Genome-Wide CRISPRi Dual-sgRNA Library (Cellecta KIDHGW-105K-P ...
-
No products found
because this supplier's products are not listed.
Cassidy M.R. Blackburn, et al.,
bioRxiv - Immunology 2020
Quote:
... media was removed and replaced with either D-10 (untreated) or D-10 + 50μg/ml oxidized LDL (hi oxLDL Kalen biomedical 770252-60) for 2 hours ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Katrin Manske, et al.,
bioRxiv - Bioengineering 2023
Quote:
20,000 Human Embryonic Kidney cells (HEK293-CD19+) expressing the CD19 antigen were seeded on a 96-well E-plate (ACEA Biosciences) over night ...
-
No products found
because this supplier's products are not listed.
Jennyfer M. Mitchell, Scott A. Nichols,
bioRxiv - Evolutionary Biology 2019
Quote:
... His-EmFAK and GST-EmITGB1 (Syd Labs) recombinant proteins ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
Parafilm (Bemis, IL, USA)
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using a diamond knife (Histo HI 4317, Diatome). Afterwards sections were stained according to Gallyas52 and with Methylene blue/ Azur II for 1 min ...
-
No products found
because this supplier's products are not listed.
Surbhi Verma, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human MDMs (hMDMs) were isolated from human PBMCs and separated from healthy human donors’ blood using PolymorphPrep (PROGEN,1895) layering and centrifugation ...
-
No products found
because this supplier's products are not listed.
Gabrielle Brandt, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... recombinant human transferrin (InVitria), 80 μg/mL ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Sandrine Huot, et al.,
bioRxiv - Immunology 2020
Quote:
... Human MPO and human Lactoferrin ELISA kits were purchased from Assaypro (St. Charles, MO, USA). MMP-9 Duoset ELISA was obtained from R&D Systems ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Alicja Przybyszewska-Podstawka, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... TGFβ (human TGFβ1, Biorbyt, Cambridge, United Kingdom), Gibson Assembly® Master Mix (NEB) ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Xindi Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-human IBA1 (Aves Labs, IBA1-0020), mouse anti-human TMEM119 (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Astrid Hendriks, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human neutrophils were freshly isolated using Polymorphprep (Alere technologies) per manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Boyang Zhao, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and σNS-ΔN17 were subcloned into the bacterial expression vector pET28 with an N-terminal His tag and a TEV protease cleavage site (Epoch Life Science). Escherichia coli DE3 cells (Novagen ...
-
No products found
because this supplier's products are not listed.
Padmapriya Sekar, et al.,
bioRxiv - Immunology 2023
Quote:
... 330 μg/mL iron-saturated human holo-transferrin (BBI solutions), 10 μg/mL recombinant human insulin (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
... Nanogold particles were developed for 3 min using GoldEnhance™ (Nanoprobes). Gold enhancement was followed by fixation with 1.6% glutaraldehyde and 0.2% tannic acid in PBS ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
William T. Molin, et al.,
bioRxiv - Genomics 2020
Quote:
... At the 2 leaf stage the seedlings were sprayed with glyphosate at 0.84 kg·ai·ha−1 using an air-pressurized indoor spray chamber (DeVries Manufacturing Co., Hollandale, MN) equipped with a nozzle mounted with 8002E flat-fan tip (Spraying Systems Co., Wheaton, IL) delivering 190 L·ha−1 at 220 kPa. ...
-
No products found
because this supplier's products are not listed.
Jonah C. Rosch, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Fluorescently labeled human serum albumin (HS1-S5-1) was purchased from NANOCS (New York, NY). The starting DNA library ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...
-
No products found
because this supplier's products are not listed.
Marco Losa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were dispensed at various volumes into human ASC-coated 1,536-well plates using contactless dispensing with an ECHO 555 Acoustic Dispenser (Labcyte). Thereby ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...