-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in samples from brain lysates of mice and cell culture supernatants were determined using corresponding ELISA kits (pro-inflammatory cytokine ELISA kits were obtained from Neobioscience technology, anti-inflammatory cytokine ELISA kits were obtained from Bioss) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Edgar, et al.,
bioRxiv - Microbiology 2019
Quote:
... 32 using the AmpliteTM Fluorimetric sn-Glycerol-3-Phosphate (Gro-3-P) Assay Kit (AAT Bioquest). GAC was released from cell wall by sequential digestion with mutanolysin hydrolase and PlyC amidase ...
-
No products found
because this supplier's products are not listed.
Qian Qin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... MAS-Seq for 10x Single Cell 3’ kit (PacBio, cat. no. 102-659-600), and individually created oligos ...
-
Cat# HY-P7040-10 μg,
10 μg, USD $170.0
Ask
Yanli Chang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3mM 3-Methyladenine(3-MA, MedChemExpress, HY-19312) and 80μM dynasore (MedChemExpress,HY-15304) ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Bacon, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 3 kDa MWCO concentrator (Sartorius), and the protein concentration was estimated using a BCA assay.
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Brandon J. Gheller, et al.,
bioRxiv - Cell Biology 2019
Quote:
3 μL of human plasma were spiked with 3 μL amino acid isotope labelled internal standards (Cambridge Isotope Laboratories, #MSK-A2-1.2) and extracted with 250 μL –20 °C methanol for 10 min and centrifuged at 4°C for 10 min at 15 000 g ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Patrick Marsall, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 µg/mL R-phycoerythrin-labeled goat anti-human IgG antibody (109-116-098, Dianova) diluted in assay buffer was added to each well and incubated for 45 mins ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Patrizia Murer, Louis Plüss, Dario Neri,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Arrays of freshly frozen human colorectal tumor (37) and healthy colon tissues (3) were obtained from Amsbio. A list of the 40 different tissues ...
-
No products found
because this supplier's products are not listed.
F. Locatelli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Whole-cell patch-clamp was performed from the soma of Golgi cells Patch pipettes were pulled from borosilicate glass capillaries (Sutter Instruments) and filled with an intracellular solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Gonzalo P. Solis, et al.,
bioRxiv - Cell Biology 2022
Quote:
... N2a cells co-expressing the GFP-fusion constructs and the MannII-mRFP Golgi marker were seeded on µ-Slide-4-wells coverslips (Ibidi). Cell were first incubated for 30 min at 37°C in HBSS supplemented with 20 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Yanbing Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Golgi-stained neurons and dendritic segments from ACC and vCA1 were examined and imaged under light microscopy (AHBT3; Olympus, Tokyo, Japan). The density of neuronal dendritic length and spines was statistically analyzed using Image J (Fuji ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Eike-Christian Wamhoff, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Sera were analyzed by ELISA for the presence of anti-dsDNA IgG and IgM using commercially available kits (Chondrex Inc. ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Tamas L Nagy, Jack Strickland, Orion D Weiner,
bioRxiv - Cell Biology 2023
Quote:
... Neutrophils were isolated using the EasySep Direct Human Neutrophil Isolation Kit (STEM-CELL Tech #19666) with the BigEasy magnet (STEMCELL Tech #18001 ...
-
No products found
because this supplier's products are not listed.
Jared A Tangeman, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 137 was performed using the CUTANA ChIC / CUT&RUN Kit Version 3 (EpiCypher, 14-1048) and CUTANA CUT&RUN Library Prep Kit (EpiCypher ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Guneet Kaur, et al.,
bioRxiv - Neuroscience 2023
Quote:
Primary human cerebral cortex microvascular endothelial cells (Passage 3, 12 CPD in vitro, ACBRI 376) were procured from Cell Systems (Kirkland, WA 98034, USA). Brain microvascular endothelial cells (BMECs ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... Pancoll human (PAN Biotech). CD19+ B cells were purified from human PBMCs using the REAlease® CD19 Microbead Kit (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Moritz Gerster, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and segmented “1–3–3–1” electrode DBS-LFP (Abbott St ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-hydroxy-3-methylglutaric acid (HMG) was obtained from TCI or Cayman Chemicals.
-
No products found
because this supplier's products are not listed.
Jeremy K. Herren, et al.,
bioRxiv - Microbiology 2019
Quote:
Plasmodium screening of human subjects was done in the regions surrounding Mbita using RDT kits (SD Bioline, UK). Microscopy was carried out on RDT-positive samples to confirm the presence of P ...
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Damon A. Hofman, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human EGF (20ng/mL; Shenandoah Biotech), human FGF-basic-154 (20ng/mL ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
Peptide YY (3-36) (human) is an endogenous appetite suppressing peptide. Peptide YY (PYY)...
Cat# P1125, SKU# P1125-5mg,
5mg, $290.00
Ask
Vivek K. Bajpai, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3 μM CHIR99021(Selleck Chemicals) was added ...
-
No products found
because this supplier's products are not listed.
Chatterjee Amit, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Syntaxin 3 (Synaptic system 110032). Each antibody was 1000-fold diluted in either 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Brendan P. Lehnert, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 mm WD objective (Nikon) with scan mirror excursions that produced a 510 x 510 μm2 field of view ...
-
No products found
because this supplier's products are not listed.
Katerina Jerabkova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... human polyclonal CREST (Antibodies Incorporated, 15 234), rabbit polyclonal Aurora B (Abcam ab2254) ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Zintis Inde, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human tissue microarrays were obtained from US Biomax, Inc ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Caroline Atyeo, et al.,
bioRxiv - Immunology 2021
Quote:
... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Noah R. Johnson, et al.,
bioRxiv - Neuroscience 2021
Quote:
... recombinant human Aβ40 (rPeptide), recombinant human scrambled Aβ42 (rPeptide) ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Russell Spencer-Smith, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3-liter Bioflo 110 (Eppendorf) were used ...