Labshake search
Citations for Avidity :
1 - 50 of 73 citations for Human Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Avi-tagged Rhesus macaque FcγRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions and tagged with streptavidin-PE ...
-
bioRxiv - Immunology 2023Quote: ... rhesus macaque FcγR2A and FcγR3A (acquired from the Duke Human Vaccine Institute Protein Production Facility) were biotinylated with a BirA biotin–protein ligase bulk reaction kit (Avidity). C1Q (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Cell Biology 2021Quote: ... Biotinylation of the AviTag in full-length human FLCN-8xG-AviTag-PreScission-MBP was performed following according to the manufacturer’s (Avidity) suggested protocol and was performed following PreScission protease cleavage and prior to size exclusion chromatography ...
-
bioRxiv - Bioengineering 2021Quote: ... BirA-500 kit was purchased from Avidity. Streptavidin (SA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then biotinylated with a commercial BirA kit (Avidity). Proteins were then purified from the BirA enzyme by affinity purification using a 1 mL HisTrap HP affinity column (Cytiva) ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2020Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Cancer Biology 2022Quote: ... MHC-peptide complexes were biotinylated using a BirA reaction kit (Avidity) per manufacturer’s instructions in the presence of excess peptide and β2M at 25°C for 4 hours ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation was performed using a BirA biotin-protein ligation kit (Avidity) on proteins produced with a C-terminal avidin tag sequence ...
-
bioRxiv - Microbiology 2020Quote: ... a BirA biotin-protein ligase kit (Avidity, LLC; Aurora, CO, USA) was used to biotinylate protein samples ...
-
bioRxiv - Evolutionary Biology 2022Quote: Biotinylation of the HAs was performed using the BirA500 kit (Avidity) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... purified fractions were biotinylated using a BirA protein ligase kit (Avidity LLC). The biotinylated proteins were further purified by gel filtration (S200 ...
-
bioRxiv - Immunology 2020Quote: ... Biotinylation was performed using biotinprotein ligase standard reaction kit (Avidity, Cat# Bir500A) following the manufacturers standard protocol and dialyzed over-night against PBS ...
-
bioRxiv - Bioengineering 2021Quote: The purified protein was biotinylated by BirA using a BirA-500 kit (Avidity). Typically ...
-
bioRxiv - Microbiology 2021Quote: ... Purified SARS2 D614G spike protein was biotinylated using BirA500 biotinylation kit from Avidity. To 50 ug of spike protein ...
-
bioRxiv - Biochemistry 2022Quote: ... Biotinylation was performed using the BirA ligase reaction kit (Avidity, cat. no. BirA500).
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of monomer was carried out using BirA biotin-protein ligase kit (Avidity) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Overnight biotinylation reactions were performed using the BirA Biotin-Protein Ligase Kit (Avidity) at 4℃ in 1x BiomixA ...
-
bioRxiv - Biochemistry 2024Quote: ... The HKU1 RBDs were biotinylated using the BirA biotin ligase reaction kit (Avidity) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Tetramers with an AviTag were biotinylated with the BirA biotin-ligase kit (Avidity) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... the purified RBDs were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity). The biotinylated proteins were re-purified and concentrated as described above ...
-
bioRxiv - Microbiology 2020Quote: ... The RBD with a BirA tag was biotinylated using a biotinylation kit (Avidity, LLC) and was immobilized through the Biotin CAPture Reagent ...
-
bioRxiv - Molecular Biology 2022Quote: ... the proteins were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity, #BirA500). Biotinylation of the NiV protein probes was confirmed by biolayer interferometry by testing the ability of the biotinylated protein to bind to streptavidin sensors ...
-
bioRxiv - Immunology 2021Quote: ... each FcγR was biotinylated using a BirA biotin-protein ligase bulk reaction kit (Avidity) according to the protocol of the manufacturer ...
-
bioRxiv - Immunology 2023Quote: BSP-tagged proteins were biotinylated using the BirA biotin-ligase bulk reaction kit (Avidity), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... biotinylation with BirA biotin-protein ligase standard reaction kit (Avidity, 318 LLC-Aurora, Colorado), and purification using size-exclusion column (Waters ...
-
bioRxiv - Immunology 2022Quote: ... VH F6 was biotinylated with BirA biotin-protein ligase standard reaction kit (BirA500, Avidity, USA). Streptavidin biosensors (ForteBio ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were biotinylated overnight at 4°C using a BirA biotinprotein ligase reaction kit (Avidity) and re-purified using the same HisTrap HP affinity method described above before being flash frozen.
-
bioRxiv - Immunology 2024Quote: ... The purified spike protein was biotinylated using the BirA biotin-protein ligase reaction kit (Avidity) following the manufacturer’s recommendation ...
-
bioRxiv - Biophysics 2021Quote: ... Ecads bound to the Ni-NTA beads were biotinylated with BirA enzyme (BirA 500 kit; Avidity) for 1hr at 300C ...
-
bioRxiv - Biophysics 2022Quote: ... Ecads bound to the Ni-NTA beads were biotinylated with BirA enzyme (BirA 500 kit; Avidity) for 1 h at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... TGEV and CCoV-HuPn-2018 were biotinylated using BirA biotin-protein ligase standard reaction kit (Avidity) following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity). Next ...
-
bioRxiv - Immunology 2020Quote: ... The RBD protein was biotinylated with the BirA biotin-protein ligase kit (Avidity LLC, Colorado, USA) using the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2021Quote: ... Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity). Next ...
-
bioRxiv - Immunology 2020Quote: ... BirA biotinylation of S proteins was conducted using BirA biotin-protein ligase bulk reaction kit (Avidity). Coronavirus S proteins with Avi-tags were concentrated to 7-9 mg/ml using 100K Amicon tubes in TBS ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were then biotinylated in vivo using a BirA biotin-protein ligase standard reaction kit (Avidity). Following the kit instructions ...
-
bioRxiv - Microbiology 2020Quote: ... S proteins with Avi-tag were pre-biotinylated using BirA biotin-protein ligase standard reaction kit (Avidity). 25 nM S-614D or 15 nM S-614G in 10X kinetic buffer (ForteBio ...
-
bioRxiv - Bioengineering 2021Quote: ... S1 protein was biotinylated at the AVI-tag using the BirA biotin-protein ligase kit (Avidity Biosciences) and premixed at 5 nM with serial dilutions of VNAR-hFc antibodies for 1 hr at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins bound to Ni-NTA were biotinylated by incubating the beads with BirA enzyme (BirA500 kit; Avidity) for 1hr in 30 °C followed by an overnight incubation at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: Biotinylation of purified Hsc70 was performed using the BirA bulk kit according to manufacturer’s protocol (Avidity LLC). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified proteins with an avi-tag were biotinylated by using BirA following the BirA500 kit’s protocol (Avidity, BirA500). Biotinylation was confirmed by performing a Coomassie gel shift assay according to Fairhead and Howarth ...
-
bioRxiv - Immunology 2022Quote: ... AviTagged tri-S and RBD proteins were biotinylated using BirA biotin-protein ligase bulk reaction kit (Avidity, LLC) or Enzymatic Protein Biotinylation Kit (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... Avi-tagged HAs were expressed and purified as described above and biotinylated using the Biotin ligase kit (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Purified mini-HA was biotinylated using the Biotin-Protein Ligase-BIRA kit according to the manufacturer’s instructions (Avidity). Biotinylated mini-HA was then conjugated to streptavidin– PE (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... avi-tagged proteins were biotinylated with a BirA500 biotin-ligase reaction kit according to the manufacturer’s instruction (Avidity). TT was purchased from Creative Biolabs (Vcar-Lsx003) ...