-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Emma T Crooks, et al.,
bioRxiv - Immunology 2021
Quote:
... followed by alkaline phosphatase labeled anti-human Fc conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT (Sigma).
-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in samples from brain lysates of mice and cell culture supernatants were determined using corresponding ELISA kits (pro-inflammatory cytokine ELISA kits were obtained from Neobioscience technology, anti-inflammatory cytokine ELISA kits were obtained from Bioss) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Diego Balboa, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Confirmation of metabolite peak specificity was achieved using commercially available standards (Merck, Cambridge Isotope Laboratories & Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Bettina Thalinger, Yannick Pütz, Michael Traugott,
bioRxiv - Molecular Biology 2020
Quote:
... The thermocycling conditions with optimum sensitivity and specificity on a Mastercycler® nexus (Eppendorf) were 15 min at 95 °C ...
-
No products found
because this supplier's products are not listed.
Karin A. Jansen, et al.,
bioRxiv - Biophysics 2020
Quote:
Human fibrinogen (FIB 3) and human α-thrombin were obtained from Enzyme Research Laboratories (Swansea, UK). FIB 3 was depleted from plasminogen ...
-
No products found
because this supplier's products are not listed.
Dimitri Ryczko, et al.,
bioRxiv - Neuroscience 2020
Quote:
The specificity of the guinea-pig anti-S100β antibody 287004 was tested by the provider (Synaptic Systems) using immunocytochemistry and western blots on cells transfected with the S100β sequence and on brain slices ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Micah Roschelle, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... we demonstrate dual color imaging with a dual-bandpass interference filter (ETFITC/Cy5m, Chroma Technology Corp), however any thin-film filter interference filter can be used ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Robert H. Utama, et al.,
bioRxiv - Bioengineering 2020
Quote:
... To fuse the right and the left sides of the images either manual dual side fusion or online dual side fusion was performed using Zen(black) (Carl Zeiss Microscopy GmbH) software package according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wei Liu, et al.,
bioRxiv - Bioengineering 2022
Quote:
Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
Building Block
Sold for research purposes only.
Cat# 2592.0, SKU# 2592-1000 mg,
1000mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anna S. Monzel, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Human NESCs were cultured on Matrigel-coated plates in N2B27 media supplemented with 3 µM CHIR-99021 (Axon Medchem), 0.75 µM purmorphamine (Enzo Life Science ...
-
No products found
because this supplier's products are not listed.
Qian Qin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... MAS-Seq for 10x Single Cell 3’ kit (PacBio, cat. no. 102-659-600), and individually created oligos ...
-
No products found
because this supplier's products are not listed.
Neil Slaven, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Dual Color 10X 1.22um/pixel Nikon Air Objective (Sartorius cat no 4464). (Green filter ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
Cat# HY-P71150-10 μg,
10 μg, USD $110.0
Ask
Yanli Chang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3mM 3-Methyladenine(3-MA, MedChemExpress, HY-19312) and 80μM dynasore (MedChemExpress,HY-15304) ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Biggs, Elizabeth A.D. Hammock,
bioRxiv - Neuroscience 2022
Quote:
... glass pipettes (3-8 MΩ, 1B150F-3, World Precision Instruments) were pulled using a horizontal puller (Sutter Instruments ...
-
No products found
because this supplier's products are not listed.
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-hydroxy-3-methylglutaric acid (HMG) was obtained from TCI or Cayman Chemicals.
-
No products found
because this supplier's products are not listed.
Katharina Ziegler, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slices were maintained at 24±1 °C using a dual TC344B temperature control system (Sutter Instruments). S1HL slices were continuously perfused with oxygenated (95%O2/ 5%CO2 ...
-
No products found
because this supplier's products are not listed.
Lina Hacker, et al.,
bioRxiv - Bioengineering 2020
Quote:
DNA was isolated from liver samples of female C57BL/6J mice (3-4 months; n=3) and Wistar rats (6-9 months; n=3) (Charles River) using the Qiagen DNeasy Blood/Tissue kit following the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Joanne Durgan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3-micron beads (Polysciences Inc) were resuspended in 0.1 M Borate and incubated with human IgG at 4°C overnight while rotating ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
The Human Genome-Wide CRISPRi Dual-sgRNA Library (Cellecta KIDHGW-105K-P ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Nathaniel P. Meyer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were stained for alkaline phosphatase as per the manufacturer’s protocol (StemAb Alkaline Phosphatase Staining Kit II, ReproCell #00-0055) and imaged using a Leica DFC 7000t microscope ...
-
No products found
because this supplier's products are not listed.
Keith J. Mickolajczyk, et al.,
bioRxiv - Biophysics 2020
Quote:
... in dual photomultiplier tube (PMT) mode ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Chu Chen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Phosphatase Inhibitor Cocktail IV (RPI), and a phosphatase inhibitor cocktail (1mM Na4P2O7 ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Patrizia Murer, Louis Plüss, Dario Neri,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Arrays of freshly frozen human colorectal tumor (37) and healthy colon tissues (3) were obtained from Amsbio. A list of the 40 different tissues ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
F Lolicato, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Imaging chambers (LabTek for FGF2 translocation assays, ibidi for Dual-color FCS) were incubated sequentially with 0.1 mg/ml Biotin-BSA (Sigma A8549 ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Sheldon D. Michaelson, et al.,
bioRxiv - Neuroscience 2019
Quote:
... using a dual-channel infusion pump (PHD ULTRA, Harvard Apparatus, Holliston, MA, USA). Vehicle (sterile saline ...
-
No products found
because this supplier's products are not listed.
Tamas L Nagy, Jack Strickland, Orion D Weiner,
bioRxiv - Cell Biology 2023
Quote:
... Neutrophils were isolated using the EasySep Direct Human Neutrophil Isolation Kit (STEM-CELL Tech #19666) with the BigEasy magnet (STEMCELL Tech #18001 ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Guneet Kaur, et al.,
bioRxiv - Neuroscience 2023
Quote:
Primary human cerebral cortex microvascular endothelial cells (Passage 3, 12 CPD in vitro, ACBRI 376) were procured from Cell Systems (Kirkland, WA 98034, USA). Brain microvascular endothelial cells (BMECs ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... Pancoll human (PAN Biotech). CD19+ B cells were purified from human PBMCs using the REAlease® CD19 Microbead Kit (Miltenyi Biotec ...
-
Phosphatase substarte (4-Nitrophenyl phosphate disodium hexahydrate, p-nitrophenyl phosphate...
Cat# E2961, SKU# E2961-250mg,
250mg, $237.00
Ask
Eunice Paisana, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Dual ATP-competitive PI3K and mTOR inhibitor Dactolisib (30mg/kg) was purchased from Selleck Chemicals (Munich, Germany). Dactolisib was freshly solved in N-Methyl-2-Pyrrolidone (NMP ...
-
No products found
because this supplier's products are not listed.
Damon A. Hofman, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human EGF (20ng/mL; Shenandoah Biotech), human FGF-basic-154 (20ng/mL ...
-
No products found
because this supplier's products are not listed.
Katerina Jerabkova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... human polyclonal CREST (Antibodies Incorporated, 15 234), rabbit polyclonal Aurora B (Abcam ab2254) ...
-
No products found
because this supplier's products are not listed.
Zintis Inde, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human tissue microarrays were obtained from US Biomax, Inc ...