-
No products found
because this supplier's products are not listed.
Marlou L. Dirks, et al.,
bioRxiv - Physiology 2023
Quote:
... Arterialized serum samples were used to determine insulin concentrations (Human insulin ELISA kit, DX-EIA-2935; Oxford Biosystems Ltd, Milton Park, UK). Serum NEFA concentrations were measured spectrophotometrically in arterialized venous and deep-venous serum samples (FA115 kit ...
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Syed Moiz Ahmed, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Endogenous TOP1cc were detected by Human Topoisomerase ICE kit (Topogen, TG1020-0) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sarah M. Mohr, et al.,
bioRxiv - Physiology 2024
Quote:
... T3 concentration was measured by ELISA (Leinco Technologies, T181). Dried product was resolubilized in the zero-standard and the kit run according to the manufacturer’s instructions.
-
This kit is a sandwich ELISA assay for the quantitative measurement of ACAT1 in human serum,...
Cat# KITE1066,
Inquiry
Ask
Ilaria Frasson, et al.,
bioRxiv - Microbiology 2023
Quote:
... We conducted genome-wide negative selection (dropout) screens in Cas9-Calu-3 cells by using the human GeCKO v2 library (Creative Biogene, cat. CCLV0001) that targets 18823 genes with 6 gRNAs/gene as well as 1000 non-targeting gRNAs ...
-
This antibody is a chicken polyclonal antibody which specifically reacts with DUSP3.
Cat# BRD-0969MZ,
Inquiry
Ask
Christopher J. Minteer, et al.,
bioRxiv - Cancer Biology 2022
Quote:
3 primary human astrocyte cell lines were derived from the cerebral cortex of one 21-year-old male donor (Creative Biolabs, #NCL-2103-P104). The 21M donor was split into Astro1 ...
-
No products found
because this supplier's products are not listed.
Kanchana Srisawat, et al.,
bioRxiv - Physiology 2023
Quote:
Body composition was measured using whole-body fan-beam dual-energy x-ray absorptiometry (DEXA; Hologic QDR Series ...
-
No products found
because this supplier's products are not listed.
Balaji Karthick Subramanian, et al.,
bioRxiv - Pathology 2019
Quote:
... Human primary podocytes from Celprogen Inc ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
Manuel Göpferich, et al.,
bioRxiv - Neuroscience 2020
Quote:
... human FGF (20 ng/μl, ReliaTech) and human EGF (Promokine) ...
-
No products found
because this supplier's products are not listed.
Chong Li, et al.,
bioRxiv - Genomics 2023
Quote:
... Hi-C libraries were generated with 1.5 M human cells as input using Proximo Hi-C kits v4.0 (Phase Genomics, Seattle, WA) according to the manufacturer’s protocol with the following change ...
-
No products found
because this supplier's products are not listed.
Charles-Francois V. Latchoumane, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 18 mice were implanted with bilateral twisted dual stainless-steel wires (A-M systems, PFA coated, 50 um diameter) targeting MD (anteroposterior ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Dawn M. Fernandez, et al.,
bioRxiv - Immunology 2019
Quote:
... All antibodies used for CITE-seq were conjugated at the Human Immune Monitoring Core at Mount Sinai using ThunderLink Plus conjugation kits (Expedeon, Cat#425-0000), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Binh Nguyen, et al.,
bioRxiv - Biochemistry 2024
Quote:
... and the fluorescence emissions were passed through a dual image splitter and recorded with an Andor iXon Ultra 897 EMCCD camera (Oxford Instruments) [79] ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
Eun Young Jeong, et al.,
bioRxiv - Biochemistry 2024
Quote:
... human preadipocytes were seeded in 12-well plates (Cellvis) and cultured to confluency ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Erica J. Polleys, et al.,
bioRxiv - Genetics 2022
Quote:
... or a-Rad51 (3 uG; Agrisera AS07 214) for 2 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Vladimir Girik, et al.,
bioRxiv - Cell Biology 2023
Quote:
3 μm carboxyl polystyrene beads (Spherotech, CP30-10) were covalently coupled with purified human IgG (hIgG ...
-
No products found
because this supplier's products are not listed.
Chao Gao, et al.,
bioRxiv - Biochemistry 2020
Quote:
... for 3 min and separated on a C18 analytical column (picofrit 75 μm ID x 150 mm, 3 μm, New Objective) using a linear gradient of 2 % to 45 % solvent B (80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Pablo S. Gaete, et al.,
bioRxiv - Biophysics 2024
Quote:
cDNAs for human Cx26 and Cx30 were synthesized and subcloned by Epoch Life Science into pGEM-HA (Promega) ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Miriam Pinilla, et al.,
bioRxiv - Immunology 2023
Quote:
... ECL revelation kit (Advansta) was used as a substrate to reveal HRP activity and membranes are imaged using ChemiDoc Imaging System (BioRad) ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Fan Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and phosphatase inhibitors (CoWin Biosciences). According to the protocol of the Pierce Crosslink Magnetic IP/Co-IP Kit (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Aleksandr Ianevski, et al.,
bioRxiv - Microbiology 2020
Quote:
We measured the IgG and IgM in human serum using Epitope Diagnostics enzyme linked immunosorbent assays (ELISA) according to manufacturer specifications (Epitope Diagnostics, San Diego, CA). Background-corrected OD values were divided by the cutoff to generate signal-to-cutoff (s/co ...
-
No products found
because this supplier's products are not listed.
Karl E Carlström, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The Casp8 ELISA (EKR1606) (Nordic Biosite, Sweden), Bid ELISA (NBP2-69968 ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Alexa Schuettenberg, et al.,
bioRxiv - Immunology 2022
Quote:
... normal human IgG (ProSci #5503) on each plate as a positive control ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Alexandra Grubman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... were transfected for 48 h with dox-inducible GFP-tagged Gateway-generated Piggybac expression constructs with inserted cDNA encoding human HIF1A and/or ELF3 open reading frames using Glial Mag transfection kit (Oz Biosciences, #GL00500) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tobias Tertel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 12 nM anti-human CD63 PE (EXBIO) or 13 nM anti-human CD81 PE (Beckman Coulter) ...
-
No products found
because this supplier's products are not listed.
Nazila V. Jafari, Jennifer L. Rohn,
bioRxiv - Microbiology 2022
Quote:
HBLAK human bladder progenitor cells (CELLnTEC, Switzerland) were grown according to the CELLnTEC protocol ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Molly Ohainle, et al.,
bioRxiv - Microbiology 2019
Quote:
... supplemented with 5% heat-inactivated human AB+ serum (Omega Scientific), 20 mM GlutaMAX-I ...
-
No products found
because this supplier's products are not listed.
Huu Tuan Nguyen, et al.,
bioRxiv - Bioengineering 2023
Quote:
Human umbilical vein endothelial cells (ECs, Angio-Proteomie, MA, USA) were cultured in Vasculife (LifeLine Cell Technology ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...