-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Jian Liu, Jean-Marie Francois, Jean-Pascal Capp,
bioRxiv - Molecular Biology 2019
Quote:
... and 1 g.L−1 5-FOA (Euromedex) or 0.06 g.L−1 canavanine (Sigma ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
No products found
because this supplier's products are not listed.
André L. Samson, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rabbit anti-RIPK3 (ProSci #2283; 1:1000/1:200), rabbit anti-human RIPK3 (Novus Biological NBP2-24588 ...
-
No products found
because this supplier's products are not listed.
Kevin P. Foley, et al.,
bioRxiv - Physiology 2020
Quote:
... Human insulin (Mercodia) and human C-peptide (Millipore ...
-
No products found
because this supplier's products are not listed.
Dang Mei, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1:1000 and 1:1500 by differential interference contrast (DIC) microscopy (OLYMPUS IX73 Inverted Microscope System with OLYMPUS DP74 Color Camera ...
-
No products found
because this supplier's products are not listed.
Josephine Volovetz, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... were added 1:1 to 35 mm glass bottom dishes (MatTek Corporation) coated with a dilute layer of Geltrex matrix ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Fiona E. Müllner, Botond Roska,
bioRxiv - Neuroscience 2023
Quote:
... Primary antibodies (goat a-ChAT Millipore AB144P 1:200 and chicken a-RFP Rockland 600-901-379 1:1000 or rabbit a-tRFP Evrogen AB233 1:1000) were prepared in light blocking solution (3% NDS ...
-
No products found
because this supplier's products are not listed.
Sodai Yoshimura, et al.,
bioRxiv - Neuroscience 2024
Quote:
... with an 1× objective (EC Plan-Neofluar 1×/0.025 M27, Carl Zeiss, Jena, Germany). The infarct area was quantified using the AxioVision Rel 4.8 software (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Vinny Verma, et al.,
bioRxiv - Biochemistry 2024
Quote:
... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
No products found
because this supplier's products are not listed.
Samuele Cancellieri, et al.,
bioRxiv - Genetics 2021
Quote:
... 100 ng ml-1 human thrombopoietin (TPO) (CellGenix, 1417-050) and 100 ng ml-1 recombinant human FMS-like Tyrosine Kinase 3 Ligand (Flt3-L ...
-
No products found
because this supplier's products are not listed.
Suhas Sureshchandra, et al.,
bioRxiv - Immunology 2020
Quote:
... in RPMI supplemented with 1% Human AB Serum (Omega Scientific) for 7 days with media supplemented on day 3 ...
-
No products found
because this supplier's products are not listed.
Sk. Kayum Alam, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... were incubated with 1 μg commercially available human IKKα protein (SignalChem) for 30 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Ling Li, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP–conjugated goat anti-human antibodies (Zen-bio, 550004; 1:5000 dilution) were added to the wells and incubated at 37°C for 1hr ...
-
No products found
because this supplier's products are not listed.
Antonin Weckel, et al.,
bioRxiv - Microbiology 2019
Quote:
... AMP concentrations were analyzed in the same supernatants by ELISA with the following kits: LL37 (Hycult,biotech), human beta defensin 1 (R&D, Novus) and human beta defensin 2 (Elabscience). The concentrations are reported as pg/mL medium ...
-
No products found
because this supplier's products are not listed.
Takafumi Kato, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The sequence encoding the full-length human EAAT2 isoform 1 (SLC1A2; Uniprot ID P43004) was amplified from a human brain complementary DNA library (Zyagen) and inserted into the pEG BacMam vector54 ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... and inoculated at a ratio of 1:1000 into pooled human serum or pooled human urine (both purchased from Lee Biosolutions). At selected time points ...
-
No products found
because this supplier's products are not listed.
Eike K. Mahlandt, et al.,
bioRxiv - Cell Biology 2021
Quote:
... BOECs were stimulated with 1 U/ml human α-thrombin (HCT-0020, Haematologic technologies) diluted in phosphate-buffered saline.
-
No products found
because this supplier's products are not listed.
Céline Besson, et al.,
bioRxiv - Pathology 2023
Quote:
... The anti-human caveolin-1 (Cav1) antibody was purchased from Tebu-bio (N-20). The rabbit anti-heme-oxygenase-1 (Hmox1 ...
-
No products found
because this supplier's products are not listed.
Martin P. Steinbuck, et al.,
bioRxiv - Immunology 2020
Quote:
... Mouse or human sera dilutions were performed in the Thaw Medium 1 (BPS Bioscience, Cat: 60187) in 96-well white clear-bottom luminescence plates (Corning ...
-
No products found
because this supplier's products are not listed.
Tyrell N. Cartwright, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.35 µM H3(1-21)-GGK-biotin peptide (Abgent) or 0.35 µM recombinant biotinylated human mononucleosomes (16-0006, Epicypher) and 0.2 mM ATP in KiPIK buffer ...
-
No products found
because this supplier's products are not listed.
Arvind R. Srivatsava, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Insulin in the supernatant from these 1 hr incubations was quantified with a Human Insulin ELISA (ALPCO; 80-INSHU-E10.1). Viable cell numbers were determined with the the Vi-Cell XR (Beckman Coulter).
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 1 ml of Human Bronchial/Tracheal Epithelial Cell (HBTEC) ALI differentiation medium (Cat# LM-0050, Lifeline® Cell Technology) supplemented with Penicillin (100 I.U./ml ...
-
No products found
because this supplier's products are not listed.
B. I. M. Wicky, et al.,
bioRxiv - Biophysics 2022
Quote:
... The following sitting drop broad screens were set up at room temperature with three protein:crystallization condition ratios (1:1, 1:2, 2:1) using the mosquito pipetting instrument (sptlabtech): Midas (Molecular Dimensions), Proplex (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Jeremy F Brooks, et al.,
bioRxiv - Immunology 2020
Quote:
Immunogens were admixed 1:1 with Alhydrogel 1% adjuvant (Accurate Chemical and Scientific Corp.) and injected i.p ...
-
No products found
because this supplier's products are not listed.
Madeleine L. Hart, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TF-1 cells were also supplemented with the 2 ng/ml Human Granulocyte Macrophage-Colony Stimulating Factor (GM-CSF) (Shenandoah Biotechnology, 100-08). Cells were incubated in a humidified incubator at 37°C with 5% CO2.
-
No products found
because this supplier's products are not listed.
Esther Dawen Yu, et al.,
bioRxiv - Immunology 2022
Quote:
... 1:1 Non Animal Protein-BLOCKER™ (G-Biosciences) in TBS was added for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Suel-Kee Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
... NANOG (AF1997, R&D, 1:200; Reprocell 1:200), OCT4A (MAB17591 ...
-
No products found
because this supplier's products are not listed.
Anna Velica, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A stock solution was made from 1 mg of CLZ (Hello Bio, batch E0697-1-1) (CLZ ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Tamara Phan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:50 cOmplete) by a Focused-ultrasonicator (Covaris M220, 1 ml) to yield chromatin fragments with an average size of 600 bp.
-
No products found
because this supplier's products are not listed.
Saikat Bhattacharya, et al.,
bioRxiv - Biochemistry 2021
Quote:
... SETD2 (Abclonal A3194, dilution 1:6000 and Aviva OAEB00589, dilution 1:3000), HA (Sigma 04-902 ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.
-
No products found
because this supplier's products are not listed.
Aaron R. Halpern, et al.,
bioRxiv - Biophysics 2021
Quote:
... approximately 40,000 cells (BSC-1, PTK-1 or hTERT RPE-1) were seeded per well in an 8-well coverglass chamber (Ibidi, 80827) and allowed to adhere overnight ...
-
No products found
because this supplier's products are not listed.
Ruben Shrestha, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and 1 g/L KNO3 or 1 g/L K15NO3 (Cambridge Isotope Laboratories), pH 5.8 ...
-
No products found
because this supplier's products are not listed.
Shiva Razavi, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
For Figure 1 and Supplementary Figure 1 Meta-Morph® software (Molecular Devices) was used to measure the average luminal and membrane fluorescence intensity for either CFP or mCherry ...
-
No products found
because this supplier's products are not listed.
Francesca Puppo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 1% Penicillin streptomycin) supplemented with 1% fetal bovine serum (FBS, Gemini Bio-products), 1 μg/ml of laminin and 0.1% ROCK (Rho kinase ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
Sierra K. Lear, Jose A. Nunez, Seth L. Shipman,
bioRxiv - Synthetic Biology 2023
Quote:
96-well glass bottom plates with #1 cover glass (Cellvis, catalog # P96-1-N) were coated with a mixture of 50% poly-D-lysine (ThermoFisher Scientific ...
-
No products found
Mercedes Lachén-Montes, et al.,
bioRxiv - Systems Biology 2022
Quote:
... and 1% penicillin/streptomycin (ABM) and grown in a 5% CO2 humidified atmosphere at 37°C ...
-
No products found
because this supplier's products are not listed.
Nihal Karakaş, et al.,
bioRxiv - Immunology 2023
Quote:
... ß-actin (1: 5000, Abbkine), α-tubulin (1 ...
-
No products found
because this supplier's products are not listed.
Erika H. Dawson, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... 1 mm zirconia (BioSpec Products) and approx ...
-
No products found
because this supplier's products are not listed.
Dale P. Corkery, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Anti-p62/SQSTM1 (PM045, WB: 1:1000, IF: 1:200) was purchased from MBL international. Mono- and polyubiquitinylated conjugates (FK2 ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
No products found
because this supplier's products are not listed.
Claire M Storey, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... Antibody binding capacity of cells was assessed using 1 µg/mL DUNP19 and anti-human IgG Simply Cellular bead standards (Bangs Laboratories, #816). Quantity of LRRC15 surface antigens available for DUNP19 binding was normalized to cell surface area (determined experimentally by confocal microscopy) ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Rémi Ronzano, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-mCherry (1:1000 to 1:2000, EnCor Biotechnology), mouse IgG2a anti-GAD67 (clone 1G10.2 ...
-
No products found
because this supplier's products are not listed.
Santosh Shivakumaraswamy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 8 ml of 1:1 paraffin oil: silicone oil (Hampton research) was poured before adding 2 μl of protein and 2 μl of the crystallization condition to each well ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1 µM PD0325901 (LC Laboratories), sterilized using 0.1 µm filter flask (Millipore) ...