Labshake search
Citations for Bio Basic :
1 - 25 of 25 citations for Flap endonuclease 1 FEN 1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
bioRxiv - Microbiology 2021Quote: ... source 1 agar (BIO BASIC, FB0010), source 2 Agar (Sangon Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... supplemented with 1/10 volume of 1.5M Tris-HCl pH 8.8 (Tris Base Fisher BP152-5, Hydrochloric Acid Fisher A144-212) and 1/10 volume 1 M DTT (Bio Basic DB0058). Samples were boiled for 5 minutes before an additional centrifugation at 4 °C at 16,000 x g for 4 minutes.
-
bioRxiv - Microbiology 2021Quote: ... 50 µg mL−1 of kanamycin (Kan; Bio Basic).
-
bioRxiv - Molecular Biology 2022Quote: ... or 1 mM MTX (Bio Basic Inc, Cat# MB0612) was added where relevant and the sample preheated at 37°C for 2 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... covered with a 1% agar pad (Agar A, Bio Basic, FB0010 ...
-
bioRxiv - Cell Biology 2022Quote: ... Yeast strains were grown in YPD (1% yeast extract (Bio Basic), 2% peptone (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 140 mM NaCl (SB0476-1; Bio Basic, Markham, Ontario, Canada) in ddH2O] for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% sodium dodecyl sulfate (SDS) and 4X Denhardt’s solution (Bio Basic D0062)] ...
-
bioRxiv - Microbiology 2023Quote: ... traNAhD4-1 and traNAQU1 were chemically synthesized and obtained from Bio Basic. sfx94 ...
-
bioRxiv - Cell Biology 2024Quote: ... and then adding 1mM IPTG (Bio Basic item number 367-93-1) for 4 hours at 37°C with shaking ...
-
bioRxiv - Molecular Biology 2019Quote: ... Os12t0613700-01) genes were codon optimized for humans and synthesized from Bio Basic Inc ...
-
bioRxiv - Systems Biology 2020Quote: ... Protein production was then induced by the addition of 1 mM IPTG (Bio Basic) and incubation at 16°C overnight with agitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Citric acid monohydrate (CAS# 5949-29-1) and sodium citrate (CAS# 6132-04-3) from Bio basic Canada Inc ...
-
bioRxiv - Biophysics 2021Quote: Genes encoding full-length human and zebrafish TRPM5 (UniProtKB accession numbers Q9NZQ8, and S5UH5, respectively) were synthesized by Bio Basic and were sub-cloned into a pEG BacMam vector with an His8 tag ...
-
bioRxiv - Molecular Biology 2020Quote: ... Strains expressing the RPB1 CTD WT or CTD mutant plasmids were grown in YNB medium lacking histidine to an OD600 of 0.5 and treated with 1 μg/mL of rapamycin (Bio Basic) for 90 min to anchor-away the endogenous Rpb1 protein ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated for 60 min at 37°C with 10 pg µl-1 of RNase A (Bio Basic, Toronto, Canada). RNase activity was inactivated by adding 100 unites of Protector RNase Inhibitor (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... Escherichia coli BL21 Rosetta (DE3) cells harboring these plasmids were induced with 0.2 mM isopropyl β-D-1-thiogalactopyranoside (Bio Basic) for 16 hours at 16 °C ...
-
bioRxiv - Biochemistry 2023Quote: A plasmid for bacterial expression of human ARL15 (1-204) was obtained by cloning codon-optimized synthetic DNA into the NdeI and BamHI cloning sites of pET15b (Bio Basic). A truncated construct (residues 32-197 ...
-
bioRxiv - Cell Biology 2019Quote: ... Knock-out cell lines were used to prepare over-expression cell lines by transfection of a pcDNA3.1(-) plasmid expressing the complete human CasD1 cDNA open reading frame synthesized by Bio Basic (Markham, Ontario, Canada). Transfected cells were selected with G418 and single cell clones screened by staining with PToV-P4 HE-Fc to identify 9-O-Ac positive cell lines ...
-
bioRxiv - Plant Biology 2019Quote: ... The target loci were amplified by PCR using specific primers (Supplementary Table 1) and resulting DNA fragments were purified with PCR purification kit (Bio Basic Inc, Canada). The wsl5 and zebra3 PCR product was digested with SacI and SalI ...
-
bioRxiv - Zoology 2020Quote: Total RNA was isolated from 1×106 Xela DS2 or Xela VS2 cells using the EZ-10 Spin Column Total RNA Minipreps Super Kit (Bio Basic Canada Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... bacteria cells were spin down and suspended in buffer H (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% Glycerol) containing 1 mg/ml lysozyme (Bio Basic, Cat. No. LDB0308-5) and 0.1 % TritonX-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... in 1x annealing buffer (5 mM Tris, 1 mM EDTA, 5 mM MgCl, Millipore, cat# 648311-1KG, Bio Basic, cat# SD8135, Bio Basic, cat# MRB0328) and placed into the thermocycler ...
-
bioRxiv - Bioengineering 2023Quote: ... were mixed with ssDNA output oligonucleotides of interest at 2x excess (Table S1) in 1x annealing buffer (5 mM Tris, 1 mM EDTA, 5 mM MgCl, Millipore, cat# 648311-1KG, Bio Basic, cat# SD8135, Bio Basic, cat# MRB0328) and placed into the thermocycler ...