-
No products found
because this supplier's products are not listed.
Nai-Wen Chi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and GCK (rabbit polyclonal, Aviva Inc. Cat. OAAF05763, 3 μg/ml). Similar staining patterns were observed (not shown ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
... Nanogold particles were developed for 3 min using GoldEnhance™ (Nanoprobes). Gold enhancement was followed by fixation with 1.6% glutaraldehyde and 0.2% tannic acid in PBS ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
John H. Klich, et al.,
bioRxiv - Bioengineering 2022
Quote:
... RAFT CTA 2-cyano-2-propyl dodecyl trithiocarbonate (2-CPDT; >97%; Strem Chemicals) was used as received ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Salman Sohrabi, Vanessa Cota, Coleen T. Murphy,
bioRxiv - Bioengineering 2023
Quote:
Molds for layer #3 and layer #5 (Figure S1d) are fabricated using SU-8 2075 (MicroChem, Newton, MA, USA) spin-coated at 2150rpm for 30s to create ∼100μm tall patterns (Figure S2a ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Erika Ganda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5 mL of sterile water and 5 mL of 100% ethanol (Decon Labs, King of Prussia, PA) were added to the tube and the pellet was resuspended by vortexing ...
-
5-Amino-4-cyano-3-(cyanomethyl)pyrazole (CAS# 54711-21-6) is a useful research reagent for the...
Cat# BB028794,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Sai Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... Elution was in buffer H containing 0.15 mg/mL 3× Flag peptide (EZBiolab). Peak fractions were diluted with 2 volumes of buffer H and loaded onto a 1-mL SP HP column (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
SAKIRUL I KHAN, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and rabbit polyclonal anti-caspase 3 (1:1000; Bioss) plus mouse monoclonal anti-CB (1:1000 ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Niek Andresen, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The cages contained fine wooden bedding material (LIGNOCEL® 3–4 S, J. Rettenmaier & Söhne GmbH + Co. KG, Rosenberg, Germany) and nest material (nestlets: Ancare, UK agents ...
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Gina M. Borgo, et al.,
bioRxiv - Microbiology 2021
Quote:
... 1 ug/mL hydrocortisone (Spectrum Chemical, CO137), and 1.18 mg/mL sodium bicarbonate).
-
No products found
because this supplier's products are not listed.
Adriaan van der Graaf, et al.,
bioRxiv - Genetics 2020
Quote:
... Cells were left unstimulated (controls) or treated for 3 hours with IFNβ (300 ng/ml, Pbl Assay science, cat 11410-2), IL-15 (20 ng/ml ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Luca Peruzzotti-Jametti, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 100 μl of Pertussis Toxin (5 ng/μl) (List Biological Laboratories) was injected intravenously (i.v. ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Fluorescence of hydrolyzed K63-linked diUb (TAMRA/QXL position 3 labeled, Boston Biochem #UF-330) was measured on a BioTek synergy LX plate reader equipped with a red filter cube assembly (ex ...
-
No products found
because this supplier's products are not listed.
Xiling Bian, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the whole mouse brain was homogenized in 3 ml of IP buffer with a glass/Teflon homogenizer (20 strokes at 2000 rpm, WHEATON, USA and WIGGENS WB2000-M, Germany) immediately after decapitation ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Chen-xi Zhang, et al.,
bioRxiv - Immunology 2020
Quote:
Compounds were purchased from TargetMol with a purity of > 98% (TargetMol). LPS (E ...