Labshake search
Citations for Omega Bio-Tek :
1 - 23 of 23 citations for Fipronil 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted in biological triplicate per condition (0.03% and 5% CO2) using the E.Z.N.A.™ Yeast RNA Kit (Omega Bio-Tek, R6870-01) as per the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were fluorescently labeled at the 5′ ends with Cy5 (Yingjun Corp. China) and purified by gel extraction (OMEGA Bio-TEK). Fluorescently-labeled DNA was then detected using a Biophotometer Plus (Eppendorf ...
-
bioRxiv - Zoology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 5–7 using an EZNA Tissue Kit (Omega Bio-tek Inc.) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from 5 mg of spleen lysate using the Omega Biotek Total RNA 96 kit (Omega Bio-Tek, Norcross, GA) and a KingFisher Flex Instrument (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The pellet of synchronized worms (L2) was treated with 4 mm steel beads and 1 mL of RNA-Solv® Reagent (Omega Bio-Tek). The mix was vortexed for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 100-bp and 1-kb molecular ladders (Omega Bio-tek, Norcross, GA, USA) were also added to gels ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 ml was immediately transferred to 2 ml disruptor tubes (Omega Bio-Tek E.Z.N.A Soil DNA; Norcross GA), then stored at -80ºC until DNA extraction ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cells or 100 μl cell culture supernatant using RNA-Solv reagent (Omega Bio-Tek) and precipitated in the presence of glycogen.
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted from 100 μl of culture supernatant using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek) and eluted in 50 μl of RNAse-free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were harvested in 1 mL RNA-Solv Reagent (Omega Bio-Tek) for RNA isolation.
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from basal internodes of 4-week-old plants using Omega Plant RNA Mini Kit (Omega Bio-Tek). About 500 ng DNAse treated RNA was used for cDNA synthesis using qScript cDNA supermix (Quanta BioSciences) ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... the entire plant was frozen and ground in liquid nitrogen from which 100 mg used for total RNA extraction using E.Z.N.A.® Plant RNA Kit (Omega Bio-tek). The RNA was converted into cDNA using SuperScript IV RT (Invitrogen cat# 18090010 ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 100-200 mg of stool using the E.Z.N.ATM Stool kit (Omega Bio-Tek Inc, GA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from 100 mg of grounded leaf tissue using the E.Z.N.A Plant Mini Kit (Omega Bio-tek, Norcross, USA) and contaminating DNA was removed using turbo DNAfree DNAse I (Ambion ...
-
bioRxiv - Molecular Biology 2021Quote: ... For RNA extraction cells were harvested with 1 ml RNAsolv reagent (Omega Bio-Tek) per 6 well and RNA was isolated according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... Final elution was standardized across all DNA extraction methods with a volume of 100 μl in non-EDTA 10 mM tris-HCL elution buffer EDTA is known to interfere with downstream sequencing (Omega Bio-Tek, Norcross USA) (pH 8.5 and at 70 °C ...
-
bioRxiv - Immunology 2024Quote: ... Transfection reactions were carried out in 100-mm cell culture dishes with the plasmid DNA (20 μg) purified with OMEGA Plasmid Maxi Kit (Omega Bio-Tek, Norcross, GA) and 40 μl of Lipofectamine 2000 reagent (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: Nasal swabs where taken from two adult healthy volunteers using STX 764 sterile small polyester swabs (Texwipe) and immediately stirred for 30 seconds in 1 ml of TRK lysis buffer (Omega Bio-tek). One volume of 70% EtOH was added ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the protein was eluted with six column volumes of 0-100% gradient of elution buffer (binding buffer with 500 mM imidazole) and 2 ml fractions were collected into 96 deep well plates (Omega Bio-tek). The collected fractions were run on SDS-PAGE gel and the fractions corresponding to His10-SUMO-RelA with the least nucleic acid contamination was collected (≈5 ml ...
-
bioRxiv - Microbiology 2023Quote: ... dissected body parts or tissues were homogenized in either 200 µl DMEM medium for end-point titration on BHK-21 cells or in 1 mL RNA-Solv reagent (Omega Bio-Tek) for RNA isolation ...