-
No products found
because this supplier's products are not listed.
Yijen L. Wu, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... mouse fetuses were secured on a tongue depressor (McKesson Medical-Surgical, Irving, TX) with Webglue surgical adhesive (n-butyl cyanoacrylate ...
-
No products found
because this supplier's products are not listed.
Michele N. Dill, et al.,
bioRxiv - Cell Biology 2022
Quote:
... with a mouse monoclonal anti-GAPDH loading control (Arigo biolaboratories ARG10112, 1:5000 dilution) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Jian Cui, et al.,
bioRxiv - Immunology 2023
Quote:
... 25 μL of HBSA containing 10 nM mouse FVIIa (Enzyme Research Laboratories, South Bend, IN), 300 nM human FX (Enzyme Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A 10 nm gold-labeled goat anti-mouse IgG secondary Ab (SPI Supplies, West Chester, PA) was used at 1:25 for 1 hr ...
-
No products found
because this supplier's products are not listed.
Aminata P. Coulibaly, et al.,
bioRxiv - Neuroscience 2019
Quote:
The arterial tree of each mouse was labeled using the vascular dye Microfil (Flow Tech, Carver, MA), and the cross-sectional MCA diameter was measured ...
-
No products found
because this supplier's products are not listed.
Julie Wells, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The left lung lobe of each mouse was fixed in neutral buffered formalin (Labchem, Inc. Pittsburgh, PA) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Patricia Aguilar-Calvo, et al.,
bioRxiv - Pathology 2023
Quote:
... full length recombinant mouse PrP (23-230) generated in E.coli was first conjugated to deferoxamine-maleimide (Macrocyclics) to produce deferoxamine-conjugated PrPC (DFO-PrPC) ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
CP Profaci, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Three hours after CNO injection the mice were live-decapitated using a mouse decapitator (LabScientific, XM-801) and brain endothelial cells were isolated for RNA sequencing.
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Ben Nicholas, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 mg of anti-MHC-I mouse monoclonal antibodies (W6/32) covalently conjugated to Protein A sepharose (Repligen) using DMP as previously described [42,43] were added to the clarified supernatants and incubated with constant agitation for 2 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Hanako Ono, et al.,
bioRxiv - Genomics 2019
Quote:
Cultured mouse organoids derived from a single cell were harvested and treated with Accumax (Innovative Cell Technologies, AM105) to generate a single-cell suspension ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Annemarie Lang, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a mouse double swing (Datesand Group, Bredbury, United Kingdom) and a Shepherd Shack (Shepherd Specialty Papers, Milford, NJ) where the entrance area was enlarged to avoid injuries due to the external fixator (57) ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
The heating pad with the mouse was then placed on top of the H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Dyah W. Karjosukarso, et al.,
bioRxiv - Systems Biology 2023
Quote:
... pH 7.4), followed by secondary antibody anti-mouse IRDye 800 (1:4000, LiCor Biosciences) and DR (1:4000, Biostatus) for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
No products found
because this supplier's products are not listed.
Mengjie Li, et al.,
bioRxiv - Microbiology 2024
Quote:
Total RNA was extracted from mouse lung tissue using an RNA extraction kit according to the manufacturer’s instructions (BioMiGA, China). All materials required for the experiment were treated with DPEC water to remove RNA enzyme (BioMiGA ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Yuka Takemon, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Mice were fully genotyped for 78,000 SNPs using the GeneSeek Mega Mouse Universal Genotyping Array (MegaMUGA) (Neogen Genomics, Lincon, NE, USA) [43] ...
-
No products found
because this supplier's products are not listed.
Jessica Spring, et al.,
bioRxiv - Microbiology 2022
Quote:
... single cell suspensions (with red blood cells) from RL-MuLV infected mouse spleens were serially diluted in Clicks medium (Irvine scientific) and were subjected to the infectious center assay (Rowe et al. ...
-
No products found
because this supplier's products are not listed.
Jared D. Chrispell, Yubin Xiong, Ellen R. Weiss,
bioRxiv - Cell Biology 2022
Quote:
... Rabbit polyclonal antibodies against zebrafish Grk7 (27) and phosphorylated mouse Grk1 (17) were generated by 21st Century Biochemicals (Marlboro, MA, USA). A novel rabbit polyclonal antibody against phosphorylated zebrafish GRK1 was also generated by 21st Century Biochemicals using the peptide ISARG[pS]FDGTAN corresponding to amino acids 16-27 of zebrafish Grk1a ...
-
No products found
because this supplier's products are not listed.
Kevin Burbidge, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The grid was then probed with donkey anti-mouse antibody conjugated to 20nm gold particles 1:200 (Cytodiagnostics #AC-20-02), diluted in block solution for 30 minutes by flotation ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
The α and β chains of the MEL5 TCR were engineered to contain mouse constant domains [20] and cloned into a single pSF-Lenti-EF1α lentiviral vector (Oxford Genetics) separated by an internal ribosomal entry site (IRES ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 20-24 mice whose tumor volume had reached ∼250 mm3 (mouse grafts) or ∼80 mm3 (human grafts) at week two after grafting received either 10 mg/kg enzalutamide (TargetMol T6002) or 0.5% DMSO (MilliporeSigma D2650 ...
-
No products found
because this supplier's products are not listed.
Kaushik Bhattacharya, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Lysates of cells or mouse tissues (20-100 μg) were subjected to SDS-PAGE and transferred onto a nitrocellulose membrane (GVS Life Science) with a wet blot transfer system (VWR) ...
-
No products found
because this supplier's products are not listed.
Malene E Lindholm, et al.,
bioRxiv - Genetics 2020
Quote:
Neonatal rat ventricular myocytes (NRVMs) were isolated from newly born rats using the neonatal rat/mouse cardiomyocyte isolation protocol from Cellutron (nc-6031) according to the specifications from the manufacturer ...
-
KRAS-SOS1 inhibitor
Sold for research purposes only.
Cat# 3053.0, SKU# 3053-25 mg,
25mg, US $539.00 / EA, EURO, €490 / EA
Ask
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... naïve WT cells were plated on irradiated MEF (mouse embryonic fibroblast conditions)/Gelatin coated plates in HENSM supplemented with ROCKi 10 µM (Axon Medchem 1683). The next day ...
-
293 cells
Cat# HY29315,
1 x 1,5mL Hype-293 + 1 x 5mL B293, USD $197.00/KIT
Ask
Sahil Shah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Then the promoter activities were tested in C20 human microglia and SIM-A9 mouse microglia cell lines using Glial-Mag kit (OZ Bioscience, Cat # GL002500). The cells were cultured under standard conditions and seeded into 96-well plates at a density of 3.0×104/100 μl ...
-
No products found
because this supplier's products are not listed.
Kryslaine L. Radomski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Twenty-to-fifteen representative images from each mouse were collected at 5,000x magnification using a JEOL JEM-1011 TEM (JEOL USA Inc., Peabody, MA) and an AMT XR50S-A digital camera (Advanced Microscopy Techniques ...
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Hanah M. Georges, et al.,
bioRxiv - Immunology 2023
Quote:
Human and mouse FMs were homogenized using a beadbug microtube homogenizer with microtubes pre-filled with high impact zirconium beads (Benchmark Scientific; Sayreville, NJ) as previously described (6) ...
-
No products found
because this supplier's products are not listed.
Erica L. Stone, et al.,
bioRxiv - Immunology 2021
Quote:
... blocks were cut in 5 μm sections that were placed on glass slides for anti-IgG (UltraPolymer Goat anti-Mouse heavy and light chain IgG-HRP, Cell IDx, San Diego, CA, USA) or anti-C3 (EPR19394 ...
-
The FSTL1 ORF Vector holds the gene (cloned by a restriction enzyme-independent method) between...
Cat# 2099401.0,
1.0 μg DNA, BC000055; 1.0 μg DNA, NM_008047; 1.0 μg DNA, NM_024369, Inquire
No citation found on bioRxiv
-
PIK-293 is a PI3K inhibitor, mostly for PI3Kδ with IC50 of 0.24 μM, 500-, 100- and 50-fold less...
Cat# 900185-01-5,
Inquire
No citation found on bioRxiv
-
Cat# DIA-0230416,
Inquiry
No citation found on bioRxiv
-
FSTL1 Fragment MS Protein Standard, is a protein fragment containing a 50-150 amino acid...
Cat# CPILF26176,
inquiry, contact supplier for pricing
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Cat# ACM142106294,
Inquire
No citation found on bioRxiv
-
Catalog: A2010011 - 0.25 mg
The hexahistidine epitope (His)6 is one of the most used...
Cat# A2010011,
USD $450.0
No citation found on bioRxiv
-
Cat# IEVs-009,
1 vial, USD $1,232
No citation found on bioRxiv
-
This enzyme catalyses the following chemical reaction: hydrolysis of anserine...
Cat# EXWM-4038,
100 ug, contact supplier for pricing
No citation found on bioRxiv
-
WB, ELISA
Cat# CDC-41,
0.1 mg, Inquire
No citation found on bioRxiv