-
No products found
because this supplier's products are not listed.
Giulia Emanuelli, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES) (Sigma, SML0601); an irreversible O-Carnitine palmitoyltransferase-1 (CPT1 ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Saba Qureshi, et al.,
bioRxiv - Cell Biology 2024
Quote:
... We performed MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) assay (cat no. V13154; Thermo Fisher) for determining cell viability after different tunicamycin treatments as per the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... was used to solubilize N-(1-(2′-(4-Isopropoxyphenoxy)-2,5’-bithiazol-5-yl)ethyl)acetamide (“ACC2 inhibitor 1”; ab142090; purchased from Abcam, Cambridge, UK), 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439 ...
-
No products found
because this supplier's products are not listed.
Patrick C. Kerstein, et al.,
bioRxiv - Neuroscience 2020
Quote:
... (S)-1-(2-Amino-2-carboxyethyl)-3-(2-carboxy-5-phenylthiophene-3-yl-methyl)-5-methylpyrimidine-2,4-dione (ACET; 1μM; Tocris Bioscience, catalog #2728).
-
No products found
because this supplier's products are not listed.
Solveigh C. Koeberle, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Cintia Checa-Rodríguez, et al.,
bioRxiv - Cell Biology 2023
Quote:
MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Pippa F. Cosper, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
No products found
because this supplier's products are not listed.
Žiga Avsec, et al.,
bioRxiv - Genomics 2020
Quote:
... ɑ-Pbx 1/2/3 (Santa Cruz, sc-888), and ɑ-Zic3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Chirag Vasavda, et al.,
bioRxiv - Neuroscience 2021
Quote:
... rabbit anti-PAK1/2/3 (Cell Signaling 2604, 1:1000), rabbit anti-phospho-Cofilin (S3 ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Yu Ti Cheng, et al.,
bioRxiv - Plant Biology 2023
Quote:
Roughly 30,000 Arabidopsis bak1-5 bkk1-1 cerk1-2 (bbc) seeds were mutagenized using 0.2% ethyl methanesulfonate (EMS). Mutagenized M1 seeds were sown on soil and allowed to grow to set seeds ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and fibroblast growth factor 2 (FGF-2, 5 ng mL-1; PeproTech). Cells were passaged before reaching 90% confluency and the medium was changed every 2–3 days.
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
John P. Gillies, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1-1/2 coverslips (Corning) sonicated in 100% ethanol for 10 min were used for the flow-chamber assembly ...
-
No products found
because this supplier's products are not listed.
Catherine F. Ruff, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were washed in 0.1M cacodylate buffer and postfixed with 1% osmium and 1.5% potassium ferrocyanide in cacodylate buffer for 1 hr at RT after sections were dehydrated in an ascending gradient of ethanol (ETOH ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
Prepared to contain higher clostripain activity. Suggested for bone, heart, liver, thyroid and...
Cat# LS004174,
100 mg, $42.00
Ask
Kai Guo, et al.,
bioRxiv - Immunology 2022
Quote:
... in DMEM containing 0.0002% L-1-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical) with antibiotics ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Katrin Linda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Medium was refreshed every 2-3 days and cells were passaged 1-2 times per week using an enzyme-free reagent (ReLeSR, Stem Cell Technologies). For autophagy induction cells were treated with 200 µM Rapamycin (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Zac Chatterton, et al.,
bioRxiv - Genomics 2022
Quote:
... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... LATS1/2 (GeneTex, GTX87014, 1:1,000), p-LATS1/2 (T1079/T1041 ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...