Labshake search
Citations for Eppendorf :
1 - 50 of 990 citations for Ethyl 5 1 3 dioxolan 2 yl 2 thiophenecarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.003% Tricaine (ethyl-3-aminobenzoate-methanesulfonate) for 60 min at 31 °C in a Thermomixer (Eppendorf, Thermomixer R) set to 100 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... The requisite number of cells (2− 5 × 105) was pelleted by centrifugation (#5810, Eppendorf, Hamburg, Germany) at 200g for 3 minutes and the supernatant was discarded ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Systems Biology 2024Quote: ... Leaf rosettes were pooled from 5 plants per biological replicate in 2 ml microcentrifuge tubes (Safelock®, Eppendorf) containing two ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Biochemistry 2024Quote: ... (2) 200 μL pipette (Eppendorf, Germany), (3 ...
-
bioRxiv - Microbiology 2024Quote: ... transferred to 2-ml tubes (Eppendorf), harvested by centrifugation at 7000 x g for 7 minutes and stored at –80°C until DNA isolation (see below).
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Microbiology 2024Quote: ... a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RealPlex 2 thermocycler (Eppendorf, 2894). All primers were designed and purchased from Integrated DNA Technologies and their sequences are listed in Supplementary file 1.
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Microbiology 2024Quote: ... The NPA positive was diluted in 2 ml of MEM without FBS and centrifuged at 200Xg for 5 min (HSR Centrifuge Eppendorf Presvac) (NPA supernatant) ...
-
bioRxiv - Microbiology 2024Quote: ... For −80°C and −20°C, spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Microbiology 2020Quote: ... nine 1 mL aliquots were centrifuged for 2 min at 2500 rcf (Eppendorf, Centrifuge 5424 R) and the MOPS-based supernatant removed ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-70 kDa lane portions were excised into 2×2 mm cubes and transferred to Protein Lo-Bind tubes (Eppendorf). Excised gels were partitioned into tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissues were fixed in 2% paraformaldehyde for 55 minutes at room temperature in 2 mL Protein LoBind tubes (Eppendorf 022431064). Fixative was removed and tissues were washed 4x 10 minutes with 1.5 mL PBS with 0.5% Triton X-100 (PBT) ...
-
bioRxiv - Microbiology 2024Quote: ... As a control, a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 2 x 107 cells per mL and 50 µL of each sample was added to 5 mL tubes (Eppendorf, Hamburg, DE), to constitute 1 million cells per flow sample.
-
bioRxiv - Cell Biology 2021Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Immunology 2021Quote: ... and collected into sterile 2 ml tubes (Eppendorf). All samples were immediately snap frozen in dry ice and stored at –80 °C until DNA extraction.
-
bioRxiv - Biochemistry 2023Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... in individual 2 mL safe-lock tubes (Eppendorf). The suspensions were briefly vortexed to homogeneity and incubated at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... connected to a 2 ml microcentrifuge tube (Eppendorf) with an air-tight metal tube cap (P-CAP 2 mL High Pressure ...
-
bioRxiv - Synthetic Biology 2023Quote: ... transferred into 2 mL reaction tubes (Eppendorf, Germany), and frozen at −20 ℃ until further use ...
-
bioRxiv - Cell Biology 2024Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Biophysics 2024Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... in individual 2 mL safe-lock tubes (Eppendorf). The suspensions were briefly vortexed to homogeneity and incubated at room temperature for 2 h ...