-
No products found
because this supplier's products are not listed.
Alexei Sorokin, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Kanamycin sulfate (PhytoTechnology Laboratories®, catalog number: K378)
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Lars Emil Larsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 5 µL Hamilton Neuros Syringe (33 gauge, point style 3, Hamilton company, USA) and a Quintessential Stereotaxic Injection System (Stoelting ...
-
No products found
because this supplier's products are not listed.
Pauline M.L. Coulon, et al.,
bioRxiv - Microbiology 2020
Quote:
... genomic DNA was extracted using a 96-wells plate gDNA extraction kit (Favorgen, Canada).
-
No products found
because this supplier's products are not listed.
Hanh T. Nguyen, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were infected at a multiplicity of infection of 3-5 with rVSV-ΔG pseudovirus bearing a luciferase gene (Kerafast) for 2 hours at 37°C and then washed 6 times with 1X PBS ...
-
No products found
because this supplier's products are not listed.
Renee J. Tamming, et al.,
bioRxiv - Neuroscience 2019
Quote:
Brains from 3-month-old mice were stained using the FD Rapid GolgiStain Kit (FD Neurotechnologies, Inc). They were then flash frozen and sectioned on a cryostat at 100µm thickness and further processed as per kit instructions ...
-
No products found
because this supplier's products are not listed.
Henriette Hoffmann-Veltung, et al.,
bioRxiv - Immunology 2022
Quote:
... The purified proteins were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under reducing and non-reducing conditions (±DTT) followed by InstantBlue (Expedeon) staining.
-
No products found
because this supplier's products are not listed.
Sana Charaoui-Boukerzaza, et al.,
bioRxiv - Microbiology 2019
Quote:
... using a plate-reader (Scan1200, Interscience).
-
No products found
because this supplier's products are not listed.
Brian R. Graziano, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 96-well #1.5 glass-bottom plates (Brooks Life Sciences) were coated with a 100 µL solution of 20 µg/mL porcine fibronectin (prepared from whole blood ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Bruce R. Levin, et al.,
bioRxiv - Microbiology 2023
Quote:
... amikacin sulfate (AstaTech, USA, Product # 40003), colistin sulfate salt (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Assunta Senatore, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The following antigens were coated on separate 384-well ELISA plates: anti-Fd antibody (The Binding Site GmbH) 1:1000 in PBS ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Steven J. Grzegorski, et al.,
bioRxiv - Genetics 2019
Quote:
... Prothrombin levels in the expression media and the cell lysate were then quantified by ELISA using a matched-pair antibody set ELISA kit (Affinity Biologicals Inc.; FII-EIA).
-
No products found
because this supplier's products are not listed.
Shoichi Ishikawa, et al.,
bioRxiv - Pathology 2021
Quote:
... Bleomycin sulfate (Bleo) was purchased from LKT Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Akhil A. Vinithakumari, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and p-cresol sulfate (pCS) and p-cresol glucuronide (pCG) were purchased from United States Biological, (Salem ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
No products found
because this supplier's products are not listed.
Gopinath Chattopadhyay, et al.,
bioRxiv - Biophysics 2022
Quote:
... The eluted fractions were pooled and dialysed thrice using a 3-5 kDa (MWCO) dialysis membrane (40mm flat width) (Spectrum Labs) against 1X PBS ...
-
No products found
because this supplier's products are not listed.
Mark S. Lee, et al.,
bioRxiv - Immunology 2023
Quote:
... 5×104 transduced 58α-β- T cell hybridomas were cocultured with 1×105 transduced I-Ek+ M12 cells in triplicate in a 96 well round bottom plate in RPMI with 5% FBS (Omega Scientific), Pen-Strep+L- Glutamine (Cytiva) ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Jing Zhou, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A 5 × 5-cm white compressed cotton pad (Nestlets, Ancare) was placed in the center of the cage ...
-
No products found
because this supplier's products are not listed.
Pragya D. Yadav, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were blocked with a Liquid Plate Sealer (CANDOR Bioscience GmbH, Germany)/ Stabilcoat (Surmodics) for two hours at 37°C ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Siiri I Salomaa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocked with and stained in 5 % milk in TBST and detected using WesternBright ECL Western Blotting detection kit (#K-12045-D20, Advansta). For Coomassie Blue staining ...
-
No products found
because this supplier's products are not listed.
Qin Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Cells were seeded into 96-well culture plates at the density of 3000 cells per well after transfected with siRNA oligos and cultured for 5 days with the viability measured daily using the Cell Counting Kit-8 (CCK8) (TargetMol) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Mohammed Samer Shaban, et al.,
bioRxiv - Immunology 2020
Quote:
... HuH7 and MRC-5 cells were confirmed to be free of mycoplasma using the Venor® GeM Classic kit (Minerva Biolabs).
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Yuanjun Shen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Softwell hydrogel-coated plates were purchased from Matrigen (Brea, CA) and used following the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Maria Alexandra Rujano, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Measures of fluorescence intensities over time (Fig. 5 and Supp. Fig. 5-1c) were performed on Volocity 6.3 (Quorum technologies). For each region (GFP only ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...