-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Victoria Zyulina, et al.,
bioRxiv - Immunology 2020
Quote:
... For direct LC differentiation CD34+ cells were cultured for 7 days in a 24 well tissue culture plate (5×104 cells per well) in serum free CellGro DC medium (CellGenix, Freiburg, Germany) supplemented with Glutamax ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Xing Xiao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 x 10-5 M DL-AP5 (DL-2-amino-5-phosphonopentanoic acid, BN0086, Biotrend), and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione ...
-
No products found
because this supplier's products are not listed.
Anitha Shenoy, et al.,
bioRxiv - Cell Biology 2022
Quote:
Collagen staining was performed on 5 μm thick sections of 4% PFA fixed paraffin-embedded lung lobes using Picro-Sirius Red Stain Kit from ScyTek Laboratories Inc ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Ved Mehta, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Precipitated sodium deoxycholate was removed by filtering through a Corning® 2 µM PVDF plate and samples were further desalted on a 96-well MacroSpin plate (The Nest Group). Peptides were eluted with 80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Cassandre Bedu-Ferrari, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5% H2 atmosphere (Coy Lab Products, USA) (Text S1) ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... followed by 5 days of decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Shannon C. Brady, et al.,
bioRxiv - Genetics 2019
Quote:
... Bleomycin sulfate was purchased from Biotang Inc via Fisher Scientific (Catalog No ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Stefania Zuppone, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... an in-house sandwich enzyme linked immunoassay (ELISA) kit (HansaBioMed Life Sciences), following the manufacturer’s protocol provided with the kit ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Pavel A. Nikitin, et al.,
bioRxiv - Immunology 2022
Quote:
... Plates were washed 3 times with endotoxin-free GVB buffer with Ca2+ and Mg2+ (GVB++, Complement Technology) and incubated with normal human serum (Complement Technology ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
because this supplier's products are not listed.
Geoffrey A. Smith, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were washed and then treated with 5 µg/ml 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) labeled LDL (Kalen Biomedical) in low-glucose DMEM with 0.5% BSA (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Salman Sohrabi, Vanessa Cota, Coleen T. Murphy,
bioRxiv - Bioengineering 2023
Quote:
Molds for layer #3 and layer #5 (Figure S1d) are fabricated using SU-8 2075 (MicroChem, Newton, MA, USA) spin-coated at 2150rpm for 30s to create ∼100μm tall patterns (Figure S2a ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Seung Woo Ryu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... An MRE11-specific shRNA (5’ACAGGAGAAGAGAUCAACUUUGuuaauauucauagCAAAGUUGAUCUCUUCUCCUGU-3’) was expressed under doxycyclin control from pRSITEP-U6Tet-(sh)-EF1-TetRep-2A-Puro (Cellecta, Inc.). BacMam constructs were generated from pAceBac1 (Geneva Biotech ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Jasvinder S. Ahuja, et al.,
bioRxiv - Genetics 2021
Quote:
... cells were pelleted and resuspended in 4 mL YPD broth containing 100 µg/mL nourseothricin sulfate (Neta Scientific) and aerated at 30°C for 12 h ...
-
No products found
because this supplier's products are not listed.
Hongkui Xiao, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were read for absorbance at 405 nm (TriStar plate reader). Resulting data were plotted as concentration (x axis ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Punn Augsornworawat, et al.,
bioRxiv - Bioengineering 2019
Quote:
... on a stirrer plate (Chemglass) set at 60 RPM in a humidified incubator set at 5% CO2 and 37 °C ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
... The 384-well source plate (Scienion) was kept at dewpoint ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
No products found
because this supplier's products are not listed.
Diana Cortes-Selva, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were coated with 2μg/mL tetanus (List Labs), diphtheria (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ke Hou, et al.,
bioRxiv - Neuroscience 2024
Quote:
... equipped with a R-AXIS HTC imaging plate detector (Rigaku). Cu K-α x-ray beam with 1.5406 Å wavelength was used ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Adil Mohamed, et al.,
bioRxiv - Microbiology 2019
Quote:
... and analysis with FSC Express 5 (De Novo Software). Identical gates were applied to all samples of a given experiment ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...
-
No products found
because this supplier's products are not listed.
Carolin Berwanger, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Resuspended cells were homogenised in a 5 mL Dounce homogeniser (Wheaton Type B) by ten quick strokes of a tight-fitting puncher avoiding foam formation ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Nima Taefehshokr, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNA isolation kits were from FroggaBio (Concord, Canada), and all laboratory chemicals were from Bioshop Canada (Burlington ...