-
No products found
because this supplier's products are not listed.
Xavier Martiáñez-Vendrell, et al.,
bioRxiv - Microbiology 2019
Quote:
... vivax pLDH proteins expressed in insect cells (3001, ReliaTech GmbH, Germany) were used as reference material ...
-
No products found
because this supplier's products are not listed.
Paula Rodrigues de Almeida, et al.,
bioRxiv - Microbiology 2019
Quote:
Monoclonal antibody against ZIKV Non-Structural 1 (NS1) protein (Arigo Biolaboratories, Taiwan, Republic of China) was diluted 1:1000 in (PBS ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Mary Y. Chang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... coli serotype 0111:B4 was purchased from List Biological Laboratories (Campbell, CA). Ifn-b was from PBL Interferon Source (Piscataway ...
-
No products found
because this supplier's products are not listed.
Aditi Madan, et al.,
bioRxiv - Physiology 2023
Quote:
... cells were incubated in Schneider’s Insect Medium without Amino Acids (United States Biological, Cat# S0100-01.10) for the indicated amount of time ...
-
No products found
because this supplier's products are not listed.
Grant M. Zane, et al.,
bioRxiv - Microbiology 2022
Quote:
AAV4 (and AAV5) VLP preparations were validated using the serotype-specific monoclonal antibodies ADK4 (Progen, 610147) and ADK5b (Origene ...
-
No products found
because this supplier's products are not listed.
Lijun Cong, et al.,
bioRxiv - Microbiology 2021
Quote:
... prior to cell supernatants being collected for quantification of virus production by HIV-1 p24 ELISA (XpressBio).
-
No products found
because this supplier's products are not listed.
Meropi Aravantinou, et al.,
bioRxiv - Immunology 2020
Quote:
... Virus titer was determined in CEMx174 cells (ATCC, Manassass, VA) by p27 ELISA quantification (ZeptoMetrix, Buffalo, NY) and syncytia scoring after 14 days with the calculation method of Reed and Meunch ...
-
No products found
because this supplier's products are not listed.
Sweta Agrawal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... we cut a small piece of insect pin (length ~1.0 mm, 0.1 mm diameter; Living Systems Instrumentation) and glued it onto the tibia and the tarsus of the right prothoracic leg ...
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... goat anti- xenotropic MLV virus antibody ABIN457298 (1:1000, antibodies-online); mouse anti- MLV gag ab100970 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Angela Ma, et al.,
bioRxiv - Microbiology 2022
Quote:
... adenovirus (D3Ultra Respiratory Virus Screening & Identification kit, Quidel, San Diego, CA), and cytomegalovirus (D3 DFA Cytomegalovirus Immediate Early Antigen Identification kit ...
-
No products found
because this supplier's products are not listed.
Youssouf Sereme, et al.,
bioRxiv - Microbiology 2020
Quote:
... A poliovirus serology-positive control serum (Poliomyelitis virus kit, GenWay, San Diego, California, USA) was also used as a control ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Yanhua Du, et al.,
bioRxiv - Epidemiology 2019
Quote:
The genomes of SFTS virus isolates were compiled using the SeqMan program in the LaserGene software package (DNAStar). The percentage similarities of nucleotide identity or amino acid identity were calculated using the ClustalX software[16] ...
-
No products found
because this supplier's products are not listed.
Amanda Thomaz, et al.,
bioRxiv - Cancer Biology 2019
Quote:
MB cells were seeded at density of 3×103 cells per well in complete medium into 96-well plates (NEST Biotechnology, Jiangsu, China). After overnight culture in complete medium ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... All secreted proteins were produced by using the transient Icosagen Cell Factory system with CHOEBNALT-85 cells and the QMCF Technology (Icosagen Cell Factory OÜ, Tartu, Estonia). Cells were maintained in a 50:50 mixture of 293 SFM II (Gibco ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Dora Buzas, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Control wells containing virus only (no ADAH11) as well as a positive control (a commercial monoclonal antibody (Absolute Antibody; Sb#15) recognising the S protein RBD ...
-
No products found
because this supplier's products are not listed.
Tyler B. Waltz, et al.,
bioRxiv - Neuroscience 2023
Quote:
Recombinant rat protein p11 (S100A10 Recombinant Protein, Aviva Systems Biology, OPCD06771) was dissolved in distilled water to obtain a final concentration of 100ug/mL and stored at -80C for less than one month ...
-
No products found
because this supplier's products are not listed.
Florencia Rago, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cells were treated with BRM011, BRM014, or BRM017 (11-point, 3-fold serial dilutions) in triplicate using an Echo550 (Labcyte). Viability was assessed on Day 0 and Day 5 using CTG according to manufacturer’s instructions ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Kristin D. Dahl, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... MBP (Myelin Basic Protein, Neuromics Cat # ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Douek-Maba Orit, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... followed by an overnight incubation at 4°C in blocking solution with anti phospho-histone 3 (PhH3) antibody or anti-caspase 3 (Cas3) antibody (both 1:300; Lifespan Bioscience. Washington US). Next ...
-
No products found
because this supplier's products are not listed.
Yan Zou, Tian Chi,
bioRxiv - Cancer Biology 2021
Quote:
PBMCs from healthy donors were purchased from HemaCare (PB009C-3). To generate IKZF3-deficient CAR-T cells ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the supernatant of each single B cell well was screened for antigen specificity through direct ELISA for targeting full-length monomeric p-S65-Ub protein (Boston Biochem, U-102), free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals) ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Reza Nouri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... LwaCas13a proteins were purchased from MCLAB (cat# CAS13a-100). Cas13a and crRNA were mixed in 1×PBS to form the non-activated Cas13a/crRNA at room temperature for 20 min and stored at -80°C ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jordana Griffiths, et al.,
bioRxiv - Immunology 2020
Quote:
... Histogram overlays were produced using FCS Express (V.3) software (De Novo Software).
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Chuan Xu, et al.,
bioRxiv - Immunology 2023
Quote:
Rabbit polyclonal antibodies against human or murine IFNε proteins were generated by using peptides derived from IFNε protein sequences (Lampire Biological Laboratories (Pipersville, PA). The specificity of antibodies was determined by western blot analysis ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Brenda Vasquez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... For these experiments we used 3 hemizygous transgenic Ai162D mice (Ai162(TIT2L-GC6s-ICL-tTA2)-D ...
-
No products found
because this supplier's products are not listed.
S. Naseeb, et al.,
bioRxiv - Genetics 2021
Quote:
... high-resolution images of phenotypic plates were taken using Phenobooth after 3 days of incubation (Singer Instruments, UK). The colony sizes were calculated in pixels using Phenosuite software (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Siv Anita Hegre, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We performed cell counting using Moxi z mini automated cell counter (ORFLO Technologies) to investigate how knockdown of the lncRNA candidates affected cell growth ...
-
No products found
because this supplier's products are not listed.
Benjamin M. Adams, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Colonies derived from a single cell were isolated using cell cloning cylinders (Bellco Glass), trypsinized from the plate ...
-
No products found
because this supplier's products are not listed.
John C Kostyak, et al.,
bioRxiv - Immunology 2024
Quote:
... Blood cell analysis was carried out using a Hemavet blood cell analyzer (Drew Scientific, Miami Lakes, FL).
-
No products found
because this supplier's products are not listed.
Ana Kucera, et al.,
bioRxiv - Immunology 2020
Quote:
... T cell cultures were re-stimulated with DCs and 10 days later T cells were stained with MART-1 dextramer (Immudex, Copenhagen, Denmark) to assess the presence of MART-1 antigen-specific T cells in the cultures.
-
No products found
because this supplier's products are not listed.
Abbigayl E.C. Burtis, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells were washed 2x with PBS containing 2% FBS (Atlas Biologicals, Fort Collins, CO). Viable T cells were enriched using the Easy Sep T cell isolation Kit followed by the Easy Sep Dead Cell removal Kit (Stem Cell Technologies ...