-
No products found
because this supplier's products are not listed.
Mostafa Jarahian, et al.,
bioRxiv - Immunology 2020
Quote:
... Complexes of NCR-Fc fusion proteins (1 to 2 μg per staining) and PE-labeled goat anti-hIgG Fc (Dianova; 1:100 in FACS buffer) were allowed to form for 30 min before being added to cells for 60 min on ice ...
-
No products found
because this supplier's products are not listed.
Pavlo Gilchuk, et al.,
bioRxiv - Immunology 2020
Quote:
A modified protocol using a commercially available human anti-zika virus Envelope protein (ZIKV-Env) IgG kit (Alpha Diagnostics International) was used to quantify ZIKV-117 mAb levels in NHP serum samples ...
-
No products found
because this supplier's products are not listed.
Komal Raj Rijal, et al.,
bioRxiv - Microbiology 2020
Quote:
... The data presented in this study represents serological diagnosis using rapid test kit (SD Bioline dengue IgG/IgM antibody up to 2015; and after 2015, SD Bioline dengue duo (dengue NS1 Ag+ IgG/IgM), Korea ...
-
No products found
because this supplier's products are not listed.
Simon J. Cleary, et al.,
bioRxiv - Immunology 2024
Quote:
... These sequences were codon-optimized and antibodies were expressed as chimeric hIgG1 with or without Fc point mutations in a HEK293 cell system and purified using protein A and buffer exchange (Absolute Antibody).
-
No products found
because this supplier's products are not listed.
Justine Creff, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 200 µg for HEK293) were incubated with 3 µg of the indicated antibodies and 12 µL protein sepharose beads (IPA300, Repligen) at 4°C for 4 h ...
-
No products found
because this supplier's products are not listed.
Jack M. O’Shea, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... and mouse anti-mCherry-Tag Monoclonal (Elabscience) at a dilution of 1:1000 for SGR58 ...
-
No products found
because this supplier's products are not listed.
Anupriya M Geethakumari, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1:5000) or with anti-Strep-tag mouse monoclonal antibody (anti-Strep-tag mouse monoclonal, C23.21; PROGEN-910STR; 1:5000) overnight at 4°C in dilution buffer (TBS-T containing 5% bovine serum albumin (BSA) ...
-
No products found
J.A. McPhail, et al.,
bioRxiv - Biochemistry 2019
Quote:
... HEK293-AT1 cells (3×105 cells/well) were plated on 29 mm circular glass-bottom culture dishes (#1.5; Cellvis) pre-coated with 0.01% poly-L-lysine solution (Sigma) ...
-
No products found
because this supplier's products are not listed.
Swastik Phulera, et al.,
bioRxiv - Biophysics 2024
Quote:
... The virus titer was determined by gp64-PE mouse anti-baculovirus antibody (Expression Systems, CA) using a Guava benchtop Flow Cytometer (Millipore ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Fc receptors were blocked for 30 min with Protein A (MP Biomedicals, OH) in Stain Buffer (554656 ...
-
No products found
because this supplier's products are not listed.
Tianjing Hu, et al.,
bioRxiv - Immunology 2022
Quote:
... Serotype-specific polyclonal anti-PS antisera used as detection labels were purchased from Cedarlane Laboratories (Burlington ...
-
No products found
because this supplier's products are not listed.
Chunru Wei, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The eluted proteins were subjected to immunoblot analysis with anti-FLAG tag polyclonal antibody (Solarbio, China). The detailed Co-IP was performed as described by Zhu and Huq [28].
-
No products found
because this supplier's products are not listed.
Juan Jauregui-Lozano, et al.,
bioRxiv - Genomics 2021
Quote:
CUT&Tag was performed using CUTANA™ CUT&Tag reagents (Epicypher, Durham NC ...
-
No products found
because this supplier's products are not listed.
Gabrielle L. Turvey, et al.,
bioRxiv - Cell Biology 2023
Quote:
... At 48 h post-transfection the supernatant containing virus was harvested and filtered through a low-protein binding filter (0.45µm, Sarstedt) to remove HEK debris ...
-
No products found
because this supplier's products are not listed.
Maria Rojec, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Cell envelopes were disrupted using a Bioruptor Plus sonication system (Diagenode s.a., Belgium) for 10 cycles ...
-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
SEC-purified protein [in SEC buffer containing 3 mM DM (Anatrace)] was reconstituted into liposomes ...
-
No products found
because this supplier's products are not listed.
Hemakumar M. Reddy, et al.,
bioRxiv - Genomics 2021
Quote:
... Trypsin digested spots were processed to obtain the protein tags by MS analysis on Hybrid Quadrupole TOF mass spectrometer (API QSTAR PULSAR i, PE SCIEX).
-
No products found
because this supplier's products are not listed.
Farès Ousalem, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein samples were injected onto a Yarra 3 µm SEC-2000 (Phenomenex) running at room temperature in 150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
José Miguel Arcas, et al.,
bioRxiv - Neuroscience 2024
Quote:
Whole-cell voltage- and current-clamp recordings were obtained from mouse DRG neurons or transiently transfected HEK293 cells with borosilicate glass patch-pipettes (Sutter Instruments, 4-8 MΩ resistance) and were performed simultaneously with temperature recordings ...
-
No products found
because this supplier's products are not listed.
Victoria L. Corbit, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Virus was injected using a syringe pump (Harvard Apparatus) fitted with a syringe (Hamilton ...
-
No products found
because this supplier's products are not listed.
Ashley A. Johnson, et al.,
bioRxiv - Physiology 2021
Quote:
... Spectra were measured from HEK293 cells using a 60x objective with NA 1.45 (Nikon) and an inverted microscope (Nikon TE-2000) ...
-
No products found
because this supplier's products are not listed.
Irene Fernández-Duran, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 20 μg retroviral plasmid were cotransfected with 2.5 μg pCMV-VSVG envelope plasmid and 7.5 μg pUMVC3-gag-pol helper vector using polyethylenimine linear (Alfa Aesar) into HEK293T cells ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Danila Boytsov, et al.,
bioRxiv - Biophysics 2022
Quote:
... the FCS unit (Confocor3, Carl Zeiss, Jena, Germany) of a commercial laser scanning microscope (LSM 510 ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Yuanzhong Zhang, et al.,
bioRxiv - Biophysics 2023
Quote:
... SARS-CoV-2 envelope protein antibody (ProSci; 9169; 1:1000), SARS-CoV-2 Nucleocapsid protein (RayBiotech ...
-
No products found
because this supplier's products are not listed.
Paola Munoz-Tello, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... using a pET-46 tobacco etch virus (TEV) protease-cleavable N-terminal hexahistidine tag fusion protein in M9 media supplemented with 15NH4Cl (Cambridge Isotope Labs, Inc.). Nurr1 LBD was eluted against a 500 mM imidazole gradient through a Ni-NTA column ...
-
No products found
because this supplier's products are not listed.
Olga M. Mazina, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3 µg of normal mouse IgG (protein A purified, Innovative Research) was incubated with 500 µl of diluted WCE (750 µg ...
-
No products found
because this supplier's products are not listed.
Tao Jing, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Viruses were generated by co-transfecting 107 cells plated the previous day in 15 cm dishes with 30 µg of total plasmid DNA (pNLX.Luc.R-.ΔAvrII and a vesicular stomatitis virus G envelope expressor at 6:1 ratio using PolyJet™ DNA transfection reagent; SignaGen Laboratories). Two days post-transfection ...
-
No products found
because this supplier's products are not listed.
Anna Lipońska, et al.,
bioRxiv - Microbiology 2024
Quote:
... For proteins with his-tag we used anti-6xHis-tag primary antibody (Covalab, ref. HIS.HS/ EH158) in dilution 1:2 000 detected with anti-mouse IRdye 800CW (LI-COR ...
-
No products found
because this supplier's products are not listed.
Min Jiang, Changyin Fang, Yongping Ma,
bioRxiv - Immunology 2023
Quote:
... Mouse anti-VSV-tag mAb were purchased from Abbkine Scientific (cat# A02180 ...
-
WB,IF,IP,IHC,FC,ELISA
Cat# A5712, SKU# A5712-20ul,
20ul, $47.00
Ask
Xuxiao He, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and Nickel Magnetic Beads for His tag protein purification (Bimake, B23602) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Chenyan Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... starting at day 3 post virus injection (250 mg tamoxifen per kg of chow, Research Diets). Mice were gavaged with two additional doses of tamoxifen (250 mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Felix Pahmeier, et al.,
bioRxiv - Microbiology 2020
Quote:
Huh7-Lunet-T7 cells expressing the dengue reporter constructs (Lunet-T7-RC) were seeded onto a glass bottom 35 cm2 dish (Mattek) at a density of 2 × 104 ...
-
No products found
because this supplier's products are not listed.
Daichi Yamasoba, et al.,
bioRxiv - Microbiology 2022
Quote:
... HEK293-ACE2 cells and HEK293-ACE2/TMPRSS2 cells were stained with rabbit anti-TMPRSS2 polyclonal antibody (BIOSS, Cat# BS-6285R, 1:100). Normal rabbit IgG (SouthernBiotech ...
-
No products found
because this supplier's products are not listed.
Lindsay Smith, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... mouse anti-PI(3)P (1:100; Echelon Biosciences Inc.), mouse anti-PI(3,4)P2 (1:100 ...
-
No products found
because this supplier's products are not listed.
Jacob W. Myerson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... with separate compartments for each mouse (MPC-3 AERO; Braintree Scientific). To maintain adequate hydration ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Fc receptor blocker (Innovex Biosciences), and finally avidin/biotin blocking buffer (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H) is used followed by development in Betazoid DAB kit (Biocare Medical #BDB2004).
-
No products found
because this supplier's products are not listed.
Neha Upadhyay-Tiwari, et al.,
bioRxiv - Plant Biology 2024
Quote:
... with an autosampler (GILSON FC 203B). Buffer B was 200 mM ammonium formate with 90% (v/v ...
-
No products found
because this supplier's products are not listed.
Martina Sundqvist, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and Tag-lite SNAP-Lumi4-Tb from Cisbio Bioassays (Codolet ...
-
Cat# HY-P70251-50 μg,
50 μg, USD $150.0
Ask
Xu Qiannan, et al.,
bioRxiv - Pathology 2020
Quote:
... Atopic dermatitis mouse model were established by applying 3 nmol MC903 (MedChemExpress, Cat. No.: HY-10001) each ear per day for 10 days ...
-
No products found
because this supplier's products are not listed.
Sergio Passarella, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 0,2 µM 5/6 TAMRA-PEG4-Alkyne tag (Jena Biosciences) and 0,2 mM freshly prepared CuSO4 ...
-
No products found
because this supplier's products are not listed.
Franziska Nadler, et al.,
bioRxiv - Biochemistry 2022
Quote:
Transient siRNA-mediated knockdown was performed by transfecting HEK293 cells with 33 nM siRNA oligonucleotides (Eurogentec) targeting the transcript of interest (see Supplementary Table S1 ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Hanna Jérôme, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
No products found
because this supplier's products are not listed.
Lingya Yao, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The α-GFP antibody (Abmart) was used to detect the NPR1-YFP protein and α-Histone 3 antibody (Agrisera) was used to detect Histone 3 (as loading control) ...
-
No products found
because this supplier's products are not listed.
Minghao Chen, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 μl of protein solution was applied onto a grid freshly glow-discharged in PELCO easiGlow system (Ted Pella). In-house graphene grids were prepared from Trivial Transfer Graphene sheets (ACS Material ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were checked for purity and presence of protein using 15% SDS-PAGE (Polyacrylamide gel electrophoresis, Mini Protean 3 System, Bio-Rad) and Coomassie Brilliant Blue (Merck ...
-
No products found
because this supplier's products are not listed.
Marion Thépaut, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Proteins were detected using InstantBlue protein stain (Expedeon) according to the supplier’s instructions.