-
No products found
because this supplier's products are not listed.
Thomas D. Avery, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
NRF2/ARE luciferase reporter HEK293 cells (SL-0042-NP, Signosis, Santa Clara, USA) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Jonathan Burnie, et al.,
bioRxiv - Microbiology 2021
Quote:
... Viruses were produced in HEK293 using Polyjet In Vitro Transfection Reagent (FroggaBio, Cat#SL100688). HEK293 cells were seeded at a density of 106 cells/mL in 6-well plates in complete media and were transfected with 3 µg of pDNA after cells had reached 70% confluence ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit (RD-IP10-Mu, Reddot biotech) were used in this study.
-
No products found
because this supplier's products are not listed.
Djem U. Kissiov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... In all cases medium contained 5% FCS (Omega Scientific), 0.2 mg/mL glutamine (Sigma) ...
-
No products found
because this supplier's products are not listed.
Pedro Gonzalez-Menendez, et al.,
bioRxiv - Physiology 2022
Quote:
... Surface GLUT1 and SLC7A1 expressions were monitored by binding to their retroviral envelope ligand (RBD) fused to eGFP for GLUT1 (1:25 dilution in 50 µls; Metafora biosystems) or to the RBD-rFc fusion protein for SLC7A1 (1:25 dilution in 50 µl ...
-
No products found
because this supplier's products are not listed.
Hongyan Sui, et al.,
bioRxiv - Immunology 2019
Quote:
HSV-1 (MacIntyre strain) and Sendai virus (SeV) were obtained from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Isaac R. Cinco, et al.,
bioRxiv - Immunology 2023
Quote:
... Goat anti-monkey IgG (Fc) HRP (Brookwood Biomedical, Jemison, AL) was diluted then added to each well and incubated for 1-1.5 hr ...
-
No products found
because this supplier's products are not listed.
Alireza Ghanbarpour, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A synthetic degron-tag peptide consisting of maleimide-GSGSWSHPQFEKAANDENYALAA (21st Century Biochemicals, Inc.), where the underlined sequence is the ssrA tag ...
-
No products found
because this supplier's products are not listed.
Victor Danelon, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult (2-3 months old) mouse brains were processed for Golgi staining as previously described (FD Rapid GolgiStain Kit, catalog #PK401, FD NeuroTechnologies) for 10d (Tran et al. ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Maria Carmen Rodenas, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Thrombin generation assay-calibrated automated thrombogram (TAG-CAT) was conducted as previously described [24] (Diagnostica Stago). Samples were processed in duplicate ...
-
No products found
because this supplier's products are not listed.
Albert S. W. Kang, et al.,
bioRxiv - Biophysics 2020
Quote:
... Purification from excess OsBp was done with spin columns (TC-100 FC from TrimGen Corporation) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Sabina Marciano, et al.,
bioRxiv - Neuroscience 2021
Quote:
... primary antibody incubation was performed for 24 h at room temperature (VMAT2: 1:5000, 20042, Immunostar, Hudson, USA, HA-tag: 1:5000, MMS- 101R, Nordic BioSite, Taby ...
-
No products found
because this supplier's products are not listed.
Magen E. Francis, et al.,
bioRxiv - Microbiology 2021
Quote:
... to confirm stability of the SARS-CoV-2 virus after culture in vDMEM (DMEM (Dulbecco’s Modified Eagle Medium) (Wisent Bioproducts (Cat # 319-005-CL)) ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Vadim Malis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and their subtraction provides flow-out signals from the tag pulse (Miyazaki et al., 2008; 2011; 2012; 2015; Wheaton et al., 2012). Both tag-on and tag-off acquisitions have the non-sel IR pulse and thus the background signals with exponential T1 relaxation magnetization returns are the same in both images ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
Caspase Assay Kit
Cat# DCS3-100,
1.0 kit, 100 tests, USD $219.0
Ask
Anne L. Rosen, et al.,
bioRxiv - Immunology 2023
Quote:
... Total protein in the urine was measured using Quantichrom Total Protein Assay Kit (CAS: QTPR-100, BioAssay Systems) according to the manufacturer’s instructions with samples detected at a 1:4-1:20 dilution ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
... Blocking solution (sciBLOCK Protein D1M solution, Scienion) was added at 200 μL/well with a multichannel pipet and allowed to incubate without agitation for 1 hour ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... The protein vaccines were alum-adjuvanted by adsorption of the recombinant fusion proteins to aluminum hydroxide (Alhydrogel®; Croda, Frederikssund, Denmark) as previously described22 ...
-
No products found
because this supplier's products are not listed.
Didier Hodzic, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Multi-Trol mouse serum controls (Drew Scientific, Inc.) were used for calibration of the Hemavet HV950 ...
-
Cat# 117137-84-5,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Justin Judd, Jonathan Lovas, Guo N. Huang,
bioRxiv - Developmental Biology 2019
Quote:
... Proteins were then transferred to PVDF-Plus membranes (Spectrum Chemical) and blocked in 5% milk in TBST (0.1% Tween 20) ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Myc 1:200 (Alfagene/Life Technologies #13-2500). The secondary antibodies (1:600 dilution ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
Proteins were separated on 4-20% Tris-Glycine NB precast minigels (NuSep) and transferred to PVDF membrane in Tris-Glycine transfer buffer with 15% methanol at 40v on ice for 3 hours ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Jeremy Ariey-Bonnet, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The reagents (compound, protein, and fluorophore) were dispensed using an Echo550 acoustic dispenser (Labcyte): 100 nL of compound (from a 100% DMSO stock at 10 mM ...
-
No products found
because this supplier's products are not listed.
Hagit Hak, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and images of protein bands were acquired and quantified using the Alliance Q9 software (UVITEC).
-
No products found
because this supplier's products are not listed.
Hao Wu, et al.,
bioRxiv - Cell Biology 2019
Quote:
PWS-IC methylation was analyzed by pyrosequencing of the intron 3 in human SNRPN gene (EpigenDX, Assay ID: ADS265-RS1), an established assay to determine the methylation status of PWS-IC (White et al. ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
C.G. Weindel, et al.,
bioRxiv - Immunology 2019
Quote:
... At least two sections per mouse were stained with an acid-fast stain (Diagnostic BioSystems) according to the manufacturer’s instructions and visualized by an Olympus BH2 light microscope.
-
No products found
because this supplier's products are not listed.
Yuki Sato, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The embryos were embedded in 3% agarose/PBS and subjected to vibratome sectioning into 140-μm-thick sections at 5100 mz (Campden Instruments). The slices were pre-blocked with 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...