-
No products found
because this supplier's products are not listed.
Yisong Qian, et al.,
bioRxiv - Immunology 2021
Quote:
... S protein (SPN-C52H4) and envelope protein (ENN-C5128) were from Acrobiosystems (Newark, DE). SARS-CoV-2 NSP1 (97-095) ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cdc42 and ARP3 proteins or ARP2/3 protein complex (Cytoskeleton) were used as bait and full-length GST-ERK3 (SignalChem ...
-
No products found
because this supplier's products are not listed.
Thomas Laval, et al.,
bioRxiv - Immunology 2021
Quote:
... coli serotype 055:B5 TLR grade was purchased from Enzo Life Sciences. Pam3Csk4 was obtained from Invivogen ...
-
No products found
because this supplier's products are not listed.
Xiaozhen Liu, et al.,
bioRxiv - Genetics 2022
Quote:
... and vesicular stomatitis virus G protein (VSV-G) plasmid using polyetherimide (PEI) (B600070, ProteinTech Group, Chicago, USA) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Aswini Panigrahi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
No products found
because this supplier's products are not listed.
Joshua J. Sims, et al.,
bioRxiv - Genetics 2021
Quote:
... We measured reporter virus transduction activity on a luminometer (BioTek) using the Renilla Glo Kit (Promega ...
-
No products found
because this supplier's products are not listed.
Annie M Goettemoeller, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the membranes were washed 3 times and biotinylated proteins were detected on Odyssey Infrared Imaging System (LI-COR Biosciences). In parallel ...
-
No products found
because this supplier's products are not listed.
Ana Lima, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and 3 μM GSK-3 inhibitor CHIR9902 (Cayman Chemicals) for 2 days at 37°C in 5% CO2 incubator ...
-
No products found
because this supplier's products are not listed.
Varun Tiwari, et al.,
bioRxiv - Biophysics 2020
Quote:
Purified GLIC protein was reconstituted into liposomes formed with 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (PE, Avanti Polar Lipids) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1’-rac-glycerol ...
-
No products found
because this supplier's products are not listed.
Komal Raj Rijal, et al.,
bioRxiv - Microbiology 2020
Quote:
... The data presented in this study represents serological diagnosis using rapid test kit (SD Bioline dengue IgG/IgM antibody up to 2015; and after 2015, SD Bioline dengue duo (dengue NS1 Ag+ IgG/IgM), Korea ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... the SARS-CoV-2 envelope (E) protein (ABclonal RP01263) or the SARS-CoV-2 spike (S ...
-
No products found
Shuai Yan, et al.,
bioRxiv - Physiology 2023
Quote:
Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...
-
No products found
because this supplier's products are not listed.
Javed Akhter, et al.,
bioRxiv - Microbiology 2020
Quote:
... The recombinant Envelope protein was obtained from MyBioSource (Cat#MBS8309649). All other reagents were from Sigma Aldrich.
-
No products found
because this supplier's products are not listed.
Aaron R. Massey, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit polyclonal antibody to WNV envelope protein (1:800, Novus Biologicals #NB100-56744), and rabbit polyclonal antibody to Iba-1 (1:200 ...
-
No products found
because this supplier's products are not listed.
Gabriele Liuzzi, Antonello Mallamaci,
bioRxiv - Developmental Biology 2023
Quote:
- αMecP2 (rat polyclonal IgG2a serotype, Active Motif #61291), 3 μg/reaction.
-
No products found
because this supplier's products are not listed.
Zhongyan Lu, et al.,
bioRxiv - Immunology 2021
Quote:
... IE2 and envelope glycoprotein B (Mabtech, OH) at a final concentration of 1 mg/ml for each individual peptide (Supplemental Table 2) ...
-
No products found
because this supplier's products are not listed.
Ellen Van Gulck, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 48h post transfection virus was collected and concentrated with PEG Virus Precipitation Kit (BioVision Inc, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Maria Rojec, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Cell envelopes were disrupted using a Bioruptor Plus sonication system (Diagenode s.a., Belgium) for 10 cycles ...
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
No products found
because this supplier's products are not listed.
Jingyi Guo Fuglstad, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Fluorescent signal from the virus was amplified by immunostaining against Red Fluorescent Protein (RFP) (catalog no.5F8, Chromotek GmbH, Germany), followed by secondary antibody-staining with Alexa 546-tagged Goat Anti-rat IgG (catalog no ...
-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
SEC-purified protein [in SEC buffer containing 3 mM DM (Anatrace)] was reconstituted into liposomes ...
-
No products found
because this supplier's products are not listed.
Farès Ousalem, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein samples were injected onto a Yarra 3 µm SEC-2000 (Phenomenex) running at room temperature in 150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
T S Sreevidya, et al.,
bioRxiv - Biophysics 2021
Quote:
The thermal and chemical denaturation of the WT and the mutant 14-3-3 proteins were performed using nano-DSF (Prometheus NT.48) from Nanotemper Technologies (Munchen ...
-
No products found
because this supplier's products are not listed.
Deike J. Omnus, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The final protein sample was concentrated (Pall Advance Centrifugal Device, MWCO 3 kDa), adjusted to 100 µM and stored in aliquots at −80°C ...
-
No products found
because this supplier's products are not listed.
Victoria L. Corbit, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Virus was injected using a syringe pump (Harvard Apparatus) fitted with a syringe (Hamilton ...
-
No products found
because this supplier's products are not listed.
Sameer Farouk Sait, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Immunodetection of RAS proteins was carried out with pan-RAS (Ab-3; Calbiochem; 1:1,000) antibodies ...
-
No products found
because this supplier's products are not listed.
Irene Fernández-Duran, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 20 μg retroviral plasmid were cotransfected with 2.5 μg pCMV-VSVG envelope plasmid and 7.5 μg pUMVC3-gag-pol helper vector using polyethylenimine linear (Alfa Aesar) into HEK293T cells ...
-
No products found
because this supplier's products are not listed.
Shih-Chia Yeh, et al.,
bioRxiv - Zoology 2022
Quote:
... and stained using 1:400 mouse monoclonal anti-envelope antibody (4G2) and 1:20,000 secondary anti-mouse Dylight 680 (Rockland). Focus forming units (ffu ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Supratim Basu, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The agro-infiltrated leaves were analyzed for protein localization at 3 dpi under a microscope (Olympus BX51-P) equipped with a UV light source ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Svenja Fritzlar, et al.,
bioRxiv - Microbiology 2023
Quote:
... virus was activated by adding 8μg/mL trypsin (TPCK treated, Worthington, Lakewood, NJ) in FCS-free media to samples in a 1:1 ratio ...
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... and given autoclaved water and a 3:1 mixture by volume of 14% protein mouse chow (Teklad Global 2014, Envigo) and black-oil sunflower seeds (Pennington Seed Inc. ...
-
No products found
because this supplier's products are not listed.
Emma Touizer, et al.,
bioRxiv - Immunology 2022
Quote:
... (3) Non-SARS-CoV-2 antigens: Peptide pools of the pp65 protein of human cytomegalovirus (CMV) (Miltenyi Biotec, Gladbach, GER), or HIV-1 gag peptide pools (NIH AIDS Reagent Repository ...
-
No products found
because this supplier's products are not listed.
Anthony J. Snyder, Andrew T. Abad, Pranav Danthi,
bioRxiv - Microbiology 2021
Quote:
... the virus-resistant cell population was transferred to fresh 150-mm dishes (Greiner Bio-One) and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Timothy P. Sheahan, et al.,
bioRxiv - Microbiology 2020
Quote:
... nanoluciferase expression as a surrogate for virus replication was quantitated on a Spectramax (Molecular Devices) plate reader according to the manufacturer’s instructions (Promega ...
-
No products found
because this supplier's products are not listed.
Leena Hussein Bajrai, et al.,
bioRxiv - Microbiology 2021
Quote:
... the plates were analyzed by observing virus-induced CPE by light microscope (Nikon-ECLIPSE-Ti), and plaque formation was determined by crystal violet staining (C0775 ...
-
No products found
because this supplier's products are not listed.
Romina Marone, et al.,
bioRxiv - Bioengineering 2023
Quote:
... containing 300 cells and with 10ng/ml IL-3 (+IL-3 treatment) or without IL-3 (-IL-3 treatment) were plated in a well of a SmartDish (StemCell Technologies, Seattle, WA, USA) in duplicates ...
-
No products found
because this supplier's products are not listed.
Casey L. Mahoney-Crane, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were developed using ImmPACT-3 3’-diaminobenzidine (DAB; Vector Labs), sequentially dehydrated as previously described (Stoyka et al. ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
Virus injection and optic fiber implantation surgery was performed in C57BL/6J mice (The Jackson Laboratory, #000664) at around P60 ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
JF Sturgill, et al.,
bioRxiv - Neuroscience 2020
Quote:
... AAV virus (300nL volume) was then pressure injected 100nL/min via a glass pipette pulled (P-97 Sutter Instruments) from borosilicate capillaries (Drummond calibrated 5ul ...
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... + 3% donkey serum (Jackson ImmunoResearch)] at room temperature for 15 mins ...
-
No products found
because this supplier's products are not listed.
Tao Jing, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Viruses were generated by co-transfecting 107 cells plated the previous day in 15 cm dishes with 30 µg of total plasmid DNA (pNLX.Luc.R-.ΔAvrII and a vesicular stomatitis virus G envelope expressor at 6:1 ratio using PolyJet™ DNA transfection reagent; SignaGen Laboratories). Two days post-transfection ...
-
No products found
because this supplier's products are not listed.
Chenyan Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... starting at day 3 post virus injection (250 mg tamoxifen per kg of chow, Research Diets). Mice were gavaged with two additional doses of tamoxifen (250 mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
No products found
because this supplier's products are not listed.
Krishnakanth Kondabolu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... guinea pig anti-neuronal nuclei protein (NeuN, also known as hexaribonucleotide-binding protein 3; 1:500, 266004, Synaptic Systems, RRID:AB_2619988); goat anti-nitric oxide synthase (NOS ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and rabbit anti-Sendai virus (SV) (1:1000, MBL International). Secondary antibody incubations were done with Alexa Fluor conjugated antibodies (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Moussira Alameddine, et al.,
bioRxiv - Physiology 2023
Quote:
... 3 months (3M), 18 months (18M ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were checked for purity and presence of protein using 15% SDS-PAGE (Polyacrylamide gel electrophoresis, Mini Protean 3 System, Bio-Rad) and Coomassie Brilliant Blue (Merck ...
-
No products found
because this supplier's products are not listed.
Marion Thépaut, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Proteins were detected using InstantBlue protein stain (Expedeon) according to the supplier’s instructions.