-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Adam J. Rocker, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA color development was monitored with an ELISA plate reader (BioTek Synergy 2 Multi-Mode Reader) at 405 nm with wavelength correction set at 650 nm ...
-
No products found
because this supplier's products are not listed.
Poshen B. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
We transduced cells with lentivirus carrying KRAB-dCas9 and sgRNA targeting candidate progrowth enhancers and performed puromycin (2 μg/ml) (InvivoGen) for three days postelectroporation to select against non-transduced cells ...
-
No products found
because this supplier's products are not listed.
Jeremy A. Herrera, et al.,
bioRxiv - Biochemistry 2019
Quote:
... then 60 °C for 2 hours while shaking at 1400 RPM (Eppendorf, ThermoMix C). To select for ECM proteins ...
-
No products found
because this supplier's products are not listed.
Yi Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Pre-enrichment for c-kit+ cells was achieved using anti-c-kit magnetic beads (Miltenyi Biotec).
-
No products found
because this supplier's products are not listed.
Patricia G. Izquierdo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... elegans cDNA library (OriGene) using 5’ AGAGAGAATGATGTTAGGAGG 3’ and 5’ AGTTGAAAATGAAAGAATAATGG 3’ (55°C annealing temperature ...
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...
-
No products found
because this supplier's products are not listed.
Annabel Biruete, et al.,
bioRxiv - Cell Biology 2023
Quote:
... serum C-terminal and intact FGF23 were determined by ELISA kits according to manufactures instruction (Quidel, San Diego, CA). Serum levels of the oxidative stress marker 8-hydroxy-2’-deoxyguanosine (8-OHdG ...
-
No products found
because this supplier's products are not listed.
Yuji Matsumoto, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
The phosphorylated neurofilament H ELISA kit (BioVendor Laboratorni Medicina AS ...
-
No products found
because this supplier's products are not listed.
Zhiqing Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Enzyme-linked immunosorbent assays (ELISA) using the human POSTN ELISA kit from Aviva Systems (Cat # OKCD09048 ...
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Briefly, ACE-2 protein (Acro Biosystems, USA) was coated onto ELISA plates (Greiner, Germany) at 1 μg/mL concentration in PBS and was incubated (for 12-72 hours ...
-
No products found
because this supplier's products are not listed.
Bahia Bekhouche, et al.,
bioRxiv - Genetics 2019
Quote:
... followed by a 30 min incubation with signal enhancer Amplify NAMP100 (GE Healthcare). The radiolabeled products were revealed using Typhoon phosphoimager.
-
Cow Presenilin Enhancer 2 Homolog (C. Elegans) (PSENEN) ELISA Kit is an ELISA Kit for the in...
Cat# abx555811-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mouse Vascular Endothelial Cell Growth Factor C (VEGF-C) ELISA Kit from CUSABIO (CSB-E07361m) was used for detection of VEGF-C protein concentration ...
-
No products found
because this supplier's products are not listed.
Shuai-Qi Liu, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... After fluorounce enhancer (Epigentek) and fluorounce developer (Epigentek ...
-
No products found
because this supplier's products are not listed.
Vidyanand Anaparti, et al.,
bioRxiv - Physiology 2019
Quote:
... C-reactive protein (CRP) levels were measured using a human high-sensitivity CRP (hs-CRP) ELISA kit (Biomatik, Canada) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Joana Rajão-Saraiva, et al.,
bioRxiv - Neuroscience 2022
Quote:
... presenilin-1 [PSEN1] and microtubule-associated protein tau [MAPT]) (Mutant Mouse Research and Resource Center at The Jackson Laboratory) was used as control.
-
No products found
because this supplier's products are not listed.
M. Giovannetti, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... elegans animals were transferred to 2 ml MN Bead Tubes Type A (Macherey-Nagel, Düren, Germany) and lysed using a Precellys Bead Beating system with an additional Cryolys cooling module (Bertin Instruments ...
-
No products found
because this supplier's products are not listed.
Tomoki Togashi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... hPC antigen (hPC:Ag) was measured using the Human Protein C AssayMaxTM ELISA Kit (Assaypro, St. Charles, MO) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
M Gueuning, et al.,
bioRxiv - Genetics 2024
Quote:
... we added 1 M of Betaine enhancer (VWR) per reaction ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Andrew H. Pham, et al.,
bioRxiv - Microbiology 2021
Quote:
... IFNα was quantified using the pan-IFNα ELISA kit (Stem Cell Technologies). IFNβ was quantified using human IFN-beta Quantikine ELISA kit (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Feng Li, et al.,
bioRxiv - Genetics 2019
Quote:
A Hi-C library was constructed with the ProxiMeta Hi-C kit from Phase Genomics v 1.0 containing the enzyme Sau3A ...
-
No products found
because this supplier's products are not listed.
Jennifer L. Reedy, et al.,
bioRxiv - Immunology 2023
Quote:
... For the R&D Duoset kits the ELISA were read using an i3X Spectrophotometer (Molecular Devices, LLC). For the LegendPlex assays ...
-
No products found
because this supplier's products are not listed.
Alice V. R. Lake, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-Smoothened homolog (Bioss antibodies, bs-2801R).
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
RBD/ACE-2 neutralization ELISA (ACROBiosystems) was performed according to manufacturer instruction ...
-
No products found
because this supplier's products are not listed.
Bukola Adeoye, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plasma levels of Herpes simplex virus 1/2 (HSV-1/2) and Clostridium tetani (tetanus)-toxoid-specific IgG were captured and measured with ELISA kits from Calbiotech and Alpha diagnostics according to manufacturers’ protocols.
-
No products found
because this supplier's products are not listed.
Anthoni M. Goodman, et al.,
bioRxiv - Neuroscience 2020
Quote:
Male and female TgF344-AD rats harboring the human Swedish amyloid precursor protein (APPswe) and delta exon 9 mutant presenilin-1 (PS1ΔE9) were bred with non-transgenic F344 females (Envigo, Indianapolis ...
-
No products found
because this supplier's products are not listed.
Heather J. Faust, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ELISA detection of aldosterone was performed using the Aldosterone ELISA Assay Kit from Eagle biosciences (ALD31-K01) according to manufacturer instructions.
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Jamie Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... elegans Fosmid Library (Source BioScience) and were amplified in bacteria using CopyControl Induction Solution (Lucigen, #CCIS125) and purified using a DNA midi prep kit (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Polina Lyuboslavsky, et al.,
bioRxiv - Neuroscience 2021
Quote:
... in PB for 2 days at 4°C (ABC reagent, VectaStain Elite ABC-HRP kit, Vector laboratories). After the 2 day incubation ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Meagan N. Esbin, et al.,
bioRxiv - Cell Biology 2024
Quote:
... + 1:1000 Enhancer (Biotium) and incubated for ∼10-15min before starting imaging ...
-
No products found
because this supplier's products are not listed.
Wu Liu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2’-C-methyladenosine (2’-C-Me-A) was obtained from Carbosynth Limited (Compton ...
-
No products found
because this supplier's products are not listed.
Mizuki Kurashina, et al.,
bioRxiv - Neuroscience 2020
Quote:
... elegans using a Zeiss LSM800 Airyscan confocal microscope (Carl Zeiss, Germany) with oil immersion lens 63x magnification (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Maternal serum samples collected at 0.6 G were analyzed for C-reactive protein (CRP) using an hsCRP ELISA kit (MP Biomedicals, Solon, OH) according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Lin- c-Kit+ cells were sorted into 2%FCS-PBS with 100µM IWR-1 (Tocris, 3532) or control vehicle ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
Senthilvelrajan Kaniyappan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... covered with either 2 nm amorphous carbon (Quantifoil, R2/1+2 nm C) or graphene were used for sample preparation ...
-
No products found
because this supplier's products are not listed.
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A p27 ELISA (Zeptometrix) was performed on each time point according to the manufacturer’s instructions to determine the amount of virus produced in each well.
-
No products found
because this supplier's products are not listed.
Daniel S. Shin, et al.,
bioRxiv - Immunology 2023
Quote:
... and blocked with Image-iT FX Signal Enhancer (Cell Signal) followed by PBS containing 0.1% (v/v) Tween20 and 5% (v/v) normal goat serum (Jackson Immunoresearch). Samples were then stained overnight at 4C with anti-CD4 (AlexaFluor488 ...
-
No products found
because this supplier's products are not listed.
Hai-Yin Wu, et al.,
bioRxiv - Biophysics 2021
Quote:
... elegans early embryos on an inverted microscope (Nikon, TE2000) using a 60X water-immersion objective (Nikon ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Peng Cui, et al.,
bioRxiv - Neuroscience 2024
Quote:
... combined with 2× c-mount extender (EX2C, Computar, USA) and c-mount adapters (U-TV1X-2 and U-CMAD3, Olympus, Japan) with Axon MultiClamp 700B amplifier and Axon Digidata 1320A digitizer (Molecular Devices ...
-
Chromatographically purified. A dialyzed, lyophilized pre-activated powder.
Cat# LS001643,
5x1 mg, $166.00
Ask
Tilman Werner, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... samples were digested with 1:50 (m/m) lysyl endopeptidase C (Fujifilm) at 42 °C for 2 hours and 1:50 (m/m) trypsin (Worthington) at 37 °C overnight ...