-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
Xu Dong, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibody information is as follows: Actived-Caspase-3 p17 polyclonal antibody (BS7004; Bioworld, USA; 1: 500) Cleaved Caspase-8 (Asp391 ...
-
No products found
because this supplier's products are not listed.
Iwona M. Pranke, et al.,
bioRxiv - Cell Biology 2022
Quote:
... proteins were detected with appropriate antibodies: K8 – mouse monoclonal ab (61038, Progen), Sel1 (sc-377350 ...
-
No products found
because this supplier's products are not listed.
Jaeseong Goh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and B103 cells were incubated in 6 mL of medium containing 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Amresco Inc., OH, USA) at 37 °C for 90 min and ASCs for 3 h ...
-
Some chitinases also display the activity defined in EC 3.2.1.17 lysozyme.
Cat# EXWM-3822,
100 ug, contact supplier for pricing
Ask
Hui Tian, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and after 2 h of incubation 3 μL of chitinase from Clostridium thermocellum (Creative Enzymes, New York, USA) was added into the appropriate wells ...
-
No products found
because this supplier's products are not listed.
Laura Schenkel, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5 the GFP-Like (Em 520/35) and DsRed-like (Em 617/73) Emission Filter Wheels and 2x Evolve 512 cameras (Photometrics; Tucson, Arizona, United States) were used ...
-
No products found
because this supplier's products are not listed.
Brahmaiah Pendyala, et al.,
bioRxiv - Microbiology 2020
Quote:
... assay (Catalog #79955) and papain-like protease (SARS-CoV-2) assay kit: protease activity (Catalog #79995) were purchased from BPS Bioscience (San Diego, CA).
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Zihao Wang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... pH 7.0 (The Protein Complex Suite F1, Molecular Dimensions, protein: precipitant ratio 2:1). The crystal was harvested and flash-cooled without adding cryo-protectant ...
-
No products found
because this supplier's products are not listed.
Douek-Maba Orit, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... followed by an overnight incubation at 4°C in blocking solution with anti phospho-histone 3 (PhH3) antibody or anti-caspase 3 (Cas3) antibody (both 1:300; Lifespan Bioscience. Washington US). Next ...
-
No products found
because this supplier's products are not listed.
Thomas J. Cahill, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Macrophages were incubated with 3 ug/mL biotinylated Hyaluronan binding protein (Amsbio) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Javier Martínez Pacheco, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Rabbit AtTOR polyclonal antibodies (Abiocode, R2854-2), rabbit polyclonal S6K1/2 antibodies (Agrisera ...
-
No products found
because this supplier's products are not listed.
MegAnne Casey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using the primary antibodies rabbit anti-cleaved caspase-3 (Trevigen) and chicken anti-Atp7a (Sigma) ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Aurélie de Rus Jacquet, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
The following antibodies were used in this study: chicken anti-microtubule-associated protein 2 (MAP2) (catalog number CPCA-MAP2, EnCor Biotechnology, Gainesville, FL); rabbit anti-tyrosine hydroxylase (TH ...
-
No products found
because this supplier's products are not listed.
Paula García-Huerta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Samples were probed with primary antibodies: Ataxin-3 (Aviva Systems Biology; Cat#ARP50507_P050), βIII-tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
George Cameron, et al.,
bioRxiv - Biophysics 2022
Quote:
... Anti-GINS antibody was affinity purified using protein A-sepharose (Covalab). For bulk replication assays ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Maria Llamazares Prada, et al.,
bioRxiv - Cell Biology 2023
Quote:
The human AT2-like cell line A549 (CCL-185, ATCC) was grown in Ham’s F12 medium (PAN Biotech, P04-14550) supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Wenyi Zhang, Yang Xie, Tianming Yang,
bioRxiv - Neuroscience 2021
Quote:
... We recorded extracellular single-unit activities with tungsten microelectrodes (FHC: 0.3-2 MΩ; AlphaOmega: 0.5-3 MΩ). Each electrode was driven by an independent microdrive (AlphaOmega EPS ...
-
No products found
because this supplier's products are not listed.
Julie G Burel, et al.,
bioRxiv - Immunology 2020
Quote:
... 2 μl of anti-human CD19-PECy7 antibody (clone HIB19, TONBO biosciences), and 3 μl of anti-human TCRab-AF488 antibody (clone IP26 ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Natalya Leneva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with 3 mol% of dipalmitoyl-phosphatidylinositol-3-phosphate (PI(3)P) (Echelon Biosciences) were prepared at a lipid concentration of 0.5 mg/ml in Buffer A by extrusion through a 0.4 μm polycarbonate filter (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Kailash Venkatraman, et al.,
bioRxiv - Biophysics 2023
Quote:
... Cells were back-diluted 1:100 in fresh CSM containing 2% glucose or 3% glycerol and shaken in a plate reader (Tecan) for 48 hours ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Lorine Debande, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Krystle C. Kalafut, et al.,
bioRxiv - Physiology 2021
Quote:
Semi-purified diets were prepared using combinations of soluble protein-free base mixtures D12450Spx or D100070801Lpx (Research Diets, Tables S1-2), cocoa butter ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Olga M. Mazina, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3 µg of normal mouse IgG (protein A purified, Innovative Research) was incubated with 500 µl of diluted WCE (750 µg ...
-
WB,ELISA
Cat# A5031, SKU# A5031-100ul,
100ul, $157.00
Ask
Qiumin Feng, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Antibodies were coupled to protein A/G Dynabeads (Bimake). A 500 μl mixture containing 150 μl of HeLa nuclear extracts (NE) ...
-
No products found
because this supplier's products are not listed.
Laura E. Burnett, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PAG tissue was dissected using a 2 mm diameter biopsy punch (ID: 2 mm, OD: 3 mm, Fine Science Tools, 18035-02). Each purification was performed independently three times and samples were stored at -80 °C until further processing ...
-
No products found
because this supplier's products are not listed.
Hiroe Suda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... TSK gel ODS-100V (2 mm ID x 150 mm, 3 µm, Tosoh, Tokyo, Japan). The column was eluted with a linear gradient from 30 to 90% mobile phase B (0.1% formic acid in acetonitrile ...
-
No products found
because this supplier's products are not listed.
Miguel Á. Muñoz-Alía, et al.,
bioRxiv - Microbiology 2022
Quote:
... Amino acid substitutions and deletions in the SARS-CoV-2 spike protein (shown in Figure 2) were introduced using standard molecular biology techniques135 and confirmed by Sanger sequencing (GENEWIZ). When indicated ...
-
No products found
because this supplier's products are not listed.
Yufei Xiang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The RBD (residues 319-541) of the SARS-Cov-2 S protein was expressed as a secreted protein in Spodoptera frugiperda Sf9 cells (Expression Systems) using the Bac-to-bac baculovirus method (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Rilee Zeinert, et al.,
bioRxiv - Biophysics 2024
Quote:
... and quickly washed with 3 µL of Nano-W Negative Stain (2% methylamine tungstate, Nanoprobes, Yaphank, NY, USA) followed by immediate incubation with 3 µL of Nano-W for 1 additional min ...
-
No products found
because this supplier's products are not listed.
Wassim Eid, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit polyconal to 14-3-3 (SA-483, Biomol); rabbit polyconal to CHK1-pS345 (2348S ...
-
No products found
because this supplier's products are not listed.
M. Nabuan Naufer, et al.,
bioRxiv - Biophysics 2019
Quote:
The 8.1 kbp dsDNA construct with a primer-template junction at one terminus was tethered between 2 μm anti-digoxigenin and 3 μm streptavidin functionalized beads (Spherotech) held in place by a micropipette tip and a dual beam optical trap ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Matthew R. McFarland, et al.,
bioRxiv - Systems Biology 2020
Quote:
... HA-tagged Gln4 protein was detected using an anti-HA antibody (HA.11 clone 16B12, Cambridge Biosciences) and SuperSignal West Femto substrate (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...