-
No products found
because this supplier's products are not listed.
Marina P Volegova, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... anti-cleaved caspase 3 antibody (Biocare CP229A) at 1:250 dilution ...
-
No products found
because this supplier's products are not listed.
Jeong Min Lee, et al.,
bioRxiv - Biochemistry 2024
Quote:
... FMS-like Tyrosine Kinase 3 Ligand (Flt3L, 100 ng/ml) (CellGenix, 1415-050) and Thrombopoietin (TPO ...
-
No products found
because this supplier's products are not listed.
Yisong Qian, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 papain-like protease (DB604) was purchased from Lifesensors (Malvern, PA). HCoV-HKU1 coronavirus nucleocapsid protein ...
-
No products found
because this supplier's products are not listed.
Yi-Ling Lu, Helen E. Scharfman,
bioRxiv - Neuroscience 2021
Quote:
... and an “interface-like” submerged-style chamber (interface-like chamber, RC-27LD, Harvard Apparatus, Figure 1B). When slices were placed in the recording chamber ...
-
12 well plate with tissue culture treated #1.5 glass-like polymer cover slip (0.175±0.010mm)....
Cat# P12-1.5P,
20/case, $221.00
Ask
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Jessica N. Spradlin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Proteins were eluted using 2 50 μL washes of PBS supplemented with 250 ng/μL 3 × FLAG peptide (ApexBio A6001). CuAAC was performed to append rhodamine-azide onto alkyne probe-labeled proteins and after addition of loading buffer samples were separated on precast 4-20% TGX gels (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were washed 3 times in PBS and incubated for 2 h with adequate secondary antibody (Dianova, Hamburg, Germany; Table 1) solution without Triton™-X-100 ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Deike J. Omnus, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The final protein sample was concentrated (Pall Advance Centrifugal Device, MWCO 3 kDa), adjusted to 100 µM and stored in aliquots at −80°C ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Wafaa B. Alsoussi, et al.,
bioRxiv - Immunology 2022
Quote:
... and antibody was purified using protein A agarose chromatography (Goldbio). Sequences were obtained from PCR reaction products and annotated using the ImMunoGeneTics (IMGT)/V- QUEST database (http://www.imgt.org/IMGT_vquest/)51,52 ...
-
No products found
because this supplier's products are not listed.
Reimi Tada, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... they were immersed in 0.05% ethyl-3-aminobenzoate (Tokyo Chemical Industry, 886-86-2). When adult male frogs were sacrificed to excise their testes for transgenesis ...
-
No products found
because this supplier's products are not listed.
Simone Franziska Glaser, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Human umbilical vein endothelial cells (HUVECs; passage 2-3) were purchased from PromoCell (#C-12203) and cultured in EBM Medium from Lonza (#CC-3121) ...
-
No products found
because this supplier's products are not listed.
Shan Goh, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated with monoclonal antibodies to bovine IFNγ and IL-2 (MABTECH). Duplicate wells were seeded with 1×105 cells per well of cryopreserved bovine PBMCs (rested overnight before use ...
-
No products found
because this supplier's products are not listed.
Qiong J Ding, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The cell viability was documented via 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Biotium, Fremont, CA).
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
Gang Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
... ACE2 protein primary antibody (BOSTER, Lot#BST19874624) and β-actin protein primary antibody (ABclonal ...
-
No products found
because this supplier's products are not listed.
T S Sreevidya, et al.,
bioRxiv - Biophysics 2021
Quote:
The thermal and chemical denaturation of the WT and the mutant 14-3-3 proteins were performed using nano-DSF (Prometheus NT.48) from Nanotemper Technologies (Munchen ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Mohit Rajabhoj, et al.,
bioRxiv - Plant Biology 2023
Quote:
... from 2 to 3-day-old WT and mea-1-/-;dme-2-/- seedlings using NucleoSpin® Plant II (MACHEREY-NAGEL). 200 ng of DNA was subjected to fragmentation using ultrasonicator (Covaris ...
-
No products found
because this supplier's products are not listed.
Kimberley R.G. Cortenbach, et al.,
bioRxiv - Immunology 2021
Quote:
... protein blocking in Akoya Antibody Diluent/Block (Akoya biosciences, MA) took place for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Yameng Huang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Purified proteins were used for customized antibody production by Abnova. Affinity purified antibodies were validated by immunoblots ...
-
No products found
because this supplier's products are not listed.
Ezarul Faradianna Lokman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Plasma was used for analyte analysis (Ghrelin, glucagon like peptide (GLP-1) and glucagon) using ELISA kit (Elabscience, China).
-
No products found
because this supplier's products are not listed.
Ranjan Sengupta, et al.,
bioRxiv - Cell Biology 2019
Quote:
Cell pellets (2-3 μl) were loaded onto copper membrane carriers (1mm x 0.5 mm; Ted Pella Inc.) and cryofixed using the EM PACT2 high pressure freezer (Leica) ...
-
No products found
because this supplier's products are not listed.
Arne H. Smits, et al.,
bioRxiv - Bioengineering 2019
Quote:
Total RNA was isolated from 2-3 million HAP1 cells using the Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer’s protocol ...
-
BCA Protein Colorimetric Detection assay Kit
Cat# K041-H1,
1.0 ea, USD $220.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kirsty R. Erickson, et al.,
bioRxiv - Neuroscience 2022
Quote:
Anxiety-like phenotypes were assessed in an elevated zero maze (Stoelting: 50cm inner diameter ...
-
No products found
because this supplier's products are not listed.
Chien-Wei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-CA125 epitope group A (Fitzgerald, OC125-like, M61704, 1:2000), anti-CA125 epitope group B (Agilent ...
-
2',3'-Dideoxyadenosine (ddA, ddAdo) is an anti-human immunodeficiency virus agent against human...
Cat# S5979, SKU# S5979-5mg,
5mg, $97.00
Ask
Alexander M. Loiben, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 nM GSK2110183 (AKT1/2/3 inhibitor; Selleck Chemicals #S7521), 1 μM AG-490 (JAK2 inhibitor with effects on EGFR kinase ...
-
No products found
because this supplier's products are not listed.
Rebecca T. Perelman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... the 3’-end azide functionalization in presence of 2’-azido-2’-deoxyadenosine-5’triphosphate (ATP-azide, Trilink Biotechnologies) using yeast poly(A ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
SLC25A1 inhibitor
Sold for research purposes only.
Cat# 3358.0, SKU# 3358-10 mg,
10mg, US $66.00 / EA, EURO, €60 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Esmi Lau Zajaczkowski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... filled to ∼1/3 volume with 2 and 0.1 mm diameter zirconia beads (Biospec, OK, USA) on ice ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Ayelén I. Groisman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Triple labeled immunofluorescence was performed using the following primary antibodies: GFP (Green Fluorescent Protein, Chicken antibody IgY Fraction 1:500, Aves Labs Inc.), PV (mouse anti-Parvalbumin monoclonal antibody ...
-
No products found
because this supplier's products are not listed.
Frauke Muecksch, et al.,
bioRxiv - Immunology 2022
Quote:
Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
No products found
because this supplier's products are not listed.
Benedikt K. Rossboth, et al.,
bioRxiv - Biophysics 2019
Quote:
Monomeric photoswitchable cyan fluorescence protein 2 (PS-CFP2, Evrogen) was C-terminally equipped with an AVI-tag (GLNDIFEAQKIEWHE ...
-
No products found
because this supplier's products are not listed.
Jakob Farnung, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Protein solution (2 μL) was mixed with reservoir solution (2 μL) on siliconized cover-slips (Hampton Research). Crystallizations were performed at room temperature ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... primary antibody in 2% BSA (Research Products International A30075) in PBST overnight at 4°C with agitation or with 1:5000 beta actin mouse monoclonal antibody (Sigma A5441 ...
-
No products found
because this supplier's products are not listed.
Felix D. Weiss, et al.,
bioRxiv - Immunology 2024
Quote:
... Primary antibodies used were NLRP3 (Cryo-2, AdipoGen Life Sciences) and β-Actin (926-42210 ...
-
No products found
because this supplier's products are not listed.
Luther M. Swift, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Samples were thawed on ice and phthalates were extracted from a 10 μL aliquot via vigorous vortexing for 30 min at 4°C in the presence of 5:3:2 methanol:acetonitrile:water (240 μL) containing an isotope labeled standard (1 μM DEHP ring-1,2-13C2, Cambridge Isotope Laboratories). Extraction supernatants were clarified via centrifugation at 18,000 rpm for 10 min at 4°C and analyzed immediately by ultra high-pressure liquid chromatography coupled to mass spectrometry (UHPLC-MS) ...
-
No products found
because this supplier's products are not listed.
Madhu Tiwari, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The VirE2 protein was detected by the anti-VirE2 polyclonal antibody (G-Biosciences, 1:10000) and anti-rabbit secondary antibody (Sigma ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Marion Thépaut, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Proteins were detected using InstantBlue protein stain (Expedeon) according to the supplier’s instructions.