-
No products found
because this supplier's products are not listed.
Oleg Mikhajlov, et al.,
bioRxiv - Cell Biology 2022
Quote:
We used Bodipy FL DHPE (Molecular probes, referred to as BodipyFL in the following ...
-
No products found
because this supplier's products are not listed.
Yue Zhao, et al.,
bioRxiv - Pathology 2023
Quote:
... Bodipy (Sigma, USA) followed by treatment with fluorescent-labeled secondary antibody and DAPI (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Shikai Hu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Sox9(fl/fl) and Yap(fl/fl) mice were purchased from Jackson Laboratories for breeding ...
-
No products found
because this supplier's products are not listed.
Marcel Rühling, et al.,
bioRxiv - Microbiology 2024
Quote:
... 10 µM BODIPY-FL-C12-ceramide (Santa Cruz, Cat.No. sc-503923) or 10 µM visible-range FRET probe (59) ...
-
No products found
because this supplier's products are not listed.
Steven Hoang-Phou, et al.,
bioRxiv - Immunology 2024
Quote:
... BODIPY-FL labeled tRNA-Lys (Promega L5001) were included in initial test reactions at 1:200 v/v scale ...
-
No products found
because this supplier's products are not listed.
Oleg Yarishkin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Borosilicate patch pipettes (WPI, Sarasota, FL) were pulled to resistances of 5 - 8 MΩ (P-2000 ...
-
No products found
because this supplier's products are not listed.
Kasturi Chandra, Dipshikha Chakravortty,
bioRxiv - Microbiology 2021
Quote:
... Specific lectins (50µg/ml lectin solution in blocking buffer for every 106 cells) (Vector Laboratories; #FL-1301, #FL-1071, #FL-1001) were added to each samples and incubated for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Caroline Soulet, et al.,
bioRxiv - Cell Biology 2024
Quote:
BODIPY (Merck, 790389),
-
No products found
because this supplier's products are not listed.
Beatrice Balboni, et al.,
bioRxiv - Biophysics 2023
Quote:
Histidine-tagged human RAD52 FL (RAD52 FL) expression vector (pET15b; Addgene) was transformed in E ...
-
No products found
because this supplier's products are not listed.
Katherine M. Stefanski, et al.,
bioRxiv - Biophysics 2020
Quote:
... and PIP2 Bodipy FL (Echelon Biosciences, Salt Lake City, UT) stocks were prepared in chloroform ...
-
No products found
because this supplier's products are not listed.
Matheus B. Victor, et al.,
bioRxiv - Neuroscience 2022
Quote:
... BODIPY-Cholesterol (Cholesterol with BODIPY at carbon-24 of the side chain) (Cayman Chemical; #24618) was used to assay the extracellular accumulation of cholesterol in monocultures of APOE3 or APOE4 iMGLs ...
-
No products found
because this supplier's products are not listed.
Binglun Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... water-immersion objective (XLUMPlan FL, Olympus, Tokyo, Japan) mounted on an upright microscope (BX51WI ...
-
No products found
because this supplier's products are not listed.
Soumya Bhattacharyya, Thomas J. Pucadyil,
bioRxiv - Biochemistry 2023
Quote:
... 1,2-dioleoyl-sn-glycero-3-phospho-(1′-myo-inositol) derivatives of phosphoinositides and BODIPY FL or BODIPY TMR phosphatidylethanolamine were from Avanti Polar Lipids. Diazirine derivatives of BODIPY FL or BODIPY TMR phosphatidylethanolamine were generated as described earlier 33,34 ...
-
No products found
because this supplier's products are not listed.
Lorenzo Lafranchi, et al.,
bioRxiv - Cell Biology 2024
Quote:
... TCO*K-containing polypeptides were labeled using either Tetrazine-Silicon Rhodamine (tet-SiR, Spirochrome) or 6-Methyl-Tetrazine-BODIPY®-FL (me-tet-BDP-FL, Jena Bioscience). Both stocks were prepared in DMF and further diluted in either RIPA buffer (lysate labeling ...
-
No products found
because this supplier's products are not listed.
Marco Canella, et al.,
bioRxiv - Cell Biology 2023
Quote:
Nikon TI2-LA-FL EPI-FL module for smFISH technology (Nikon, Japan).
-
No products found
because this supplier's products are not listed.
Jingyan Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... BioMek FX (Beckman Coulter, Miami, FL, USA), then transferred to 384-well Echo Qualified source-plates (Labcyte Inc ...
-
No products found
because this supplier's products are not listed.
Rishi Drolia, et al.,
bioRxiv - Microbiology 2023
Quote:
... with ×40/0.25 NA HC FL PLAN or a ×100/1.40 NA HC FL PLAN oil immersion objective and a DFC310 FX (Leica) camera-controlled by Leica Application Suite ...
-
No products found
because this supplier's products are not listed.
Haider Al-janabi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and OG488 DHPE (AAT Bioquest) in ethanol ...
-
No products found
because this supplier's products are not listed.
Sarah Lehnert, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Rho-DHPE) and imaged with a Deltavision wide-field microscope (Applied Precision). The components were dried ...
-
No products found
because this supplier's products are not listed.
Isha Ralhan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 μg/ml CholEsteryl BODIPY 542/563 C11 (BD-CE) or 5 μg/ml BODIPY 493/503 (BD493 ...
-
No products found
because this supplier's products are not listed.
Silvia Benito-Kwiecinski, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... The construct AAVS-Puro-CAG-fl-STOP-fl-Cas9 was linearized with MluI (NEB, R3198S) and FseI (NEB ...
-
No products found
because this supplier's products are not listed.
Claudia C. Pinizzotto, et al.,
bioRxiv - Neuroscience 2022
Quote:
... slow-release pellets (Innovative Research of America, Sarasota, FL) were implanted into the surgical site ...
-
No products found
because this supplier's products are not listed.
Janna M. Emery, et al.,
bioRxiv - Physiology 2023
Quote:
... MULTI-TROL mouse control blood (Drew Scientific, Inc., Miami Lakes, FL) was run prior to mouse blood samples to calibrate the HEMAVET system and assess sample quality control ...
-
No products found
because this supplier's products are not listed.
Benjamin L. Springstein, et al.,
bioRxiv - Microbiology 2020
Quote:
... Alexa Fluor 488 and BODIPY™ FL Vancomycin (Van-FL) fluorescence was visualized using filter set 38 (Carl Zeiss; excitation: 470/40 nm band pass (BP) filter ...
-
No products found
because this supplier's products are not listed.
Trung The Tran, et al.,
bioRxiv - Immunology 2022
Quote:
... Bodipy-NHS (Lumiprobe), and Pacific Blue-NHS (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Rebecca Fima, et al.,
bioRxiv - Pathology 2023
Quote:
... bodipy-labeled oxLDL were concentrated using Spin-X UF concentrator (Corning) to approximately 2 mg protein/mL ...
-
No products found
because this supplier's products are not listed.
Hao Qian, et al.,
bioRxiv - Neuroscience 2020
Quote:
... green Retrobeads IX (Lumafluor, Naples, FL) were unilaterally injected at two sites into the striatum on the same side of AAV injection ...
-
No products found
because this supplier's products are not listed.
Jianmin Su, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or anti-Fl (1:2000, Roche) antibodies followed by fluorescent staining with Tyramide Signal Amplification system (PerkinElmer) ...
-
No products found
because this supplier's products are not listed.
Kim S. Robinson, et al.,
bioRxiv - Immunology 2022
Quote:
... Full length GSDMD-FL (Abcam, #ab210070, ab209845), IL1β p17 specific (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Jelly H.M. Soffers, et al.,
bioRxiv - Genomics 2021
Quote:
... The capturing antibody (rabbit FL Gcn5 (Genscript), rat high affinity anti HA (MilliporeSigma 11867423001) ...
-
No products found
because this supplier's products are not listed.
Robin Beaven, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... in order to conjugate a TMR-C5-maleimide Bodipy dye (BioRad, CA, USA), to make fluorescent TMR-C5-maleimide-SPTISITAPIDVLRKTWAKENMRKQMQINREYLKNLQamide (DH37-F) ...
-
No products found
because this supplier's products are not listed.
Mithil Soni, et al.,
bioRxiv - Immunology 2023
Quote:
... CA) except for Viability Dyes (Miltenyi Biotec, FL). Flow cytometry was performed on PBMCs or cultured cells ...
-
No products found
because this supplier's products are not listed.
Adam R. Blanden, et al.,
bioRxiv - Biochemistry 2020
Quote:
... FL-p53 was purified by nickel-NTA chromatography (Qiagen) following manufacturers protocols ...
-
No products found
because this supplier's products are not listed.
Sunny Zhihong Jiang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... anti-c-Fos (1:5000, EnCor Biotechnology Inc., Gainesville, FL), anti-Egr-1 (15F7 ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 100 ng/ml recombinant FLT1-FC (R&D Systems, 7756-FL), 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie ...
-
No products found
because this supplier's products are not listed.
Mei Lin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The fluorescence intensity of supernatant (corresponding to BODIPY FL PtdIns(4,5)P2 or BODIPY FL PC extraction) was detected using the Infinite 200 Pro fluorescence plate reader (Tecan). In sedimentation-based PtdIns(4,5)P2 transfer assay ...
-
No products found
because this supplier's products are not listed.
Reshmi Mukherjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Synthetic 2′-FL (s2′-FL) was purchased from Carbosynth (www.carbosynth.com). The c2′-FL contains 94.1 % 2′-FL ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Aoyama, et al.,
bioRxiv - Plant Biology 2024
Quote:
Ten μM of BODIPY-IAA2 was dissolved in DMSO and the spectrum of BODIPY-IAA2 were measured using SpectraMax iD5 (Molecular Devices). To obtain Emission spectra ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Aoyama, et al.,
bioRxiv - Plant Biology 2024
Quote:
... BODIPY-IAA or BODIPY-Indole and 5 μM IAA in f 60×15 mm petri dish (Greiner Bio One, Cat. No. 628 160) and petri dishes were put vertically and incubated at 22°C for 4 h ...
-
No products found
because this supplier's products are not listed.
Qizhi Qin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... BMSCs derived from either p53fl/fl;Rbfl/fl (DKO) or p53fl/fl;Rbfl/fl;Nell1fl/fl (TKO) mice and were treated with either Ad-GFP-2A-iCre (Vector Biolabs, Cat No. 1772) or Ad-CMV-GFP (Vector Biolabs ...
-
No products found
because this supplier's products are not listed.
Dominik A. Rothen, et al.,
bioRxiv - Immunology 2021
Quote:
... Fluorospot plate (Mabtech, Cat no. 3654-FL) was coated with 100μL RBD (50μg/mL ...
-
No products found
because this supplier's products are not listed.
Jeffrey R. Liddell, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Ex490nm/Em517nm for oxidised C11-BODIPY in an EnSpire multimode plate reader (PerkinElmer). Lipid peroxidation was calculated as the ratio of oxidised to reduced C11-BODIPY after correcting for background fluorescence ...
-
No products found
because this supplier's products are not listed.
Uddalak Majumdar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Usp9xfl/fl mice were obtained from Charles River Laboratories ...
-
No products found
because this supplier's products are not listed.
Dakota R. Kamm, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 6-week-old male RIPCreMPC2-/- and littermate fl/fl control mice were fed 60% high-fat diet for 10 weeks (D12492, Research Diets Inc., New Brunswick, NJ, USA). Based on body weight ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2021
Quote:
... FL expression vector was generated by In-fusion Cloning System (Takara), amplifying the cDNA by using specific primers overlapping both the synthetic gene and the acceptor empty vector pTK1A ...
-
No products found
because this supplier's products are not listed.
Abida lslam Pranty, et al.,
bioRxiv - Neuroscience 2024
Quote:
Cells were fixed in 4% paraformaldehyde (PFA) (Polysciences, Warrington, FL, USA) for 10 min at room temperature (RT) ...
-
No products found
because this supplier's products are not listed.
Xing Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Perfluorooctane sulfonate (PFOS) was purchased from SynQuest Labs (Alachua, FL, USA). LiTFSI and PFOS were dissolved in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Uswa Shahzad, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Proteins were then transferred onto polyvinylidene Fluoride Transfer Membranes (Pall Corporation, Pensacola, FL), and subsequently blocked with 5% skim milk in TBST (20mM Tris aminomethane ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a Bgl2 site was introduced into SHH-FL after Gly198 by Quikchange (Agilent) using primers (forward 5’ GTGGCGGCCAAATCCGGCGGCAGATCTGGCTGTTTCCCGGGATCCGCC and reverse 5’ ggcggatcccgggaaacagccagatctgccgccggatttggccgccac) ...
-
No products found
because this supplier's products are not listed.
Lucía Peña-Pérez, et al.,
bioRxiv - Immunology 2022
Quote:
... 5ng/ml murine SCF and 5ng/ml human FL (PeproTech). Additional FL (5ng/ml ...