Labshake search
Citations for Agilent :
1 - 6 of 6 citations for BODIPY FL DHPE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... a Bgl2 site was introduced into SHH-FL after Gly198 by Quikchange (Agilent) using primers (forward 5’ GTGGCGGCCAAATCCGGCGGCAGATCTGGCTGTTTCCCGGGATCCGCC and reverse 5’ ggcggatcccgggaaacagccagatctgccgccggatttggccgccac) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mutations in KASH5-FL and LIC were introduced with a QuikChange site-directed mutagenesis kit (Agilent) using complementary mutant primers ...
-
bioRxiv - Cell Biology 2023Quote: ... site-directed mutagenesis was carried out on pBridge ApoER2-FL using the QuikChange mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2024Quote: ... The following equation was then used to calculate the EE: Fluorescent intensities of the samples were measured at 485/515nm for BODIPY and 500/530nm for Rh123 using a Synergy H1 microplate reader (Agilent Technologies, Santa Clara, CA) and analyzed via Gen5 3.11.19 software ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were imaged on brightfield every 6h in a 48h time course with a 4X PL FL magnification in a Cytation 7 automated microscope (Agilent). Cell count was performed using the Gen5 (v.3.12 ...
-
bioRxiv - Genomics 2020Quote: ... The constructed expression vector named pET28a-SUMO-MyoD-FL was transformed into the Escherichia coli strain BL21 (DE3) (Agilent Technologies, Santa Clara, CA, USA). The cells were grown in LB medium supplemented with 50 mg/ml kanamycin at 37°C until OD600 reached 0.6-0.8 ...