-
No products found
because this supplier's products are not listed.
Julia I. Ries, et al.,
bioRxiv - Microbiology 2022
Quote:
... The monoclonal anti-FD antibody was from BioPorto Diagnostics A/S ...
-
No products found
because this supplier's products are not listed.
Robyn M. Barfield, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The murine anti-maytansine antibody was made by ProMab and validated in-house ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
... the secondary antibody Histofine Simple Stain MAX PO® anti-goat or anti-rabbit (Nacalai USA, Inc., San Diego, CA) was administered for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Thomas Germe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for 10 min before incubating at 4°C overnight with monoclonal antibody (either anti-GyrA-CTD – 4D3 or anti-GyrB-CTD – 9G8; a gift from Alison Howells, Inspiralis) diluted 1/1000 in TBS-T 5% milk ...
-
No products found
because this supplier's products are not listed.
Scott Birks, et al.,
bioRxiv - Bioengineering 2023
Quote:
... prior to being tagged with a rabbit anti-nesprin2 antibody (1:300; ImmuQuest IQ565). After primary antibody tagging ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and immunostained with the following antibodies: mouse anti-HCV NS4A (Genotype 1B, 1:100, Virogen), rabbit anti-HA (1:100 ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Maria Zhivagui, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Immunofluorescence staining was carried out using anti-cyclobutane pyrimidine dimers (CPDs) monoclonal antibodies (clone KTM53, Kamiya Biomedical) and anti-6-4 photoproducts monoclonal antibodies (Clone 64M-2 ...
-
No products found
because this supplier's products are not listed.
Assunta Senatore, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The following antigens were coated on separate 384-well ELISA plates: anti-Fd antibody (The Binding Site GmbH) 1:1000 in PBS ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Amy R. Rappaport, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were incubated with anti-nucleocapsid protein primary antibody cocktail (clones HM1056 and HM1057) (EastCoast Bio, North Berwick, ME) for 60 minutes at 37°C (Battelle Memorial Institute ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Brandon T. Cisneros, Neal K. Devaraj,
bioRxiv - Synthetic Biology 2020
Quote:
... 3-Methylxanthine was purchased from AK Scientific (Union City, CA). Xanthine was purchased from Chem Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Jacqueline M. Tokarew, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 0.4 % horseradish peroxidase solution was prepared using HRP-linked anti-rabbit secondary antibody diluted in Stabilizyme solution (SurModics SZ02). Each read was set up in triplicate on a white polystyrene 96-well plate (ThermoFisher 236105 ...
-
No products found
because this supplier's products are not listed.
Anil Verma, et al.,
bioRxiv - Immunology 2023
Quote:
... were labeled with biotinylated anti-His tag monoclonal antibody (ThermoScientific) and used to capture His-tagged clade C gp120 Du151 protein (Immune Technologies). The gp120-expressing beads were then incubated with triplicate 5-fold dilutions of heat-inactivated serum samples in V-bottom plates for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
Mouse monoclonal antibody specific for Dengue virus serotype 3 NS1 (clone CC6)
Cat# MAB12149-100,
100µg USD $305.35
Ask
Jiarui Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... wild type cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM CF568-labled gRNA FISH probes and 1:500 anti-Spike antibodies (Cat# PAB21477-500, The Native Antigen Company) for 4 hours in the dark ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
anti-3-Oxotricyclo[2.2.1.02,6]heptane-7-carboxylic acid (CAS# 50703-32-7 ) is a useful research chemical.
Cat# 50703-32-7,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
José R Pittaluga, et al.,
bioRxiv - Immunology 2024
Quote:
... A PVP-free polycarbonate membrane (3 µm pore size; Neuro Probe Inc. Gaithersburg MD, USA) separated cells from lower wells containing either RPMI or the stimulus (pRNA or CM) ...
-
No products found
because this supplier's products are not listed.
Midori Ohta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Yiwei Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
... They were either combined at a 1 : 1 ratio or separately subjected to 3% H2O2 (Spectrum Chemical) and incubated at 37°C with 200rpm shaking for up to 2h ...
-
No products found
because this supplier's products are not listed.
Toshiomi Katsuki, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 30 µg/body 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate labelled HDL (Dil-HDL: KALEN Biomedical, MD, USA) was used ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
X. Zhao, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Then the membranes were blocked for 1hr with 3% (w/v) non-fat dry milk (LabScientific Inc., Highlands, NJ). After washing with phosphate-buffered saline plus 0.1% of Tween-20 (PBST) ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Florencia Rago, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cells were treated with BRM011, BRM014, or BRM017 (11-point, 3-fold serial dilutions) in triplicate using an Echo550 (Labcyte). Viability was assessed on Day 0 and Day 5 using CTG according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Dani Flinkman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and filtered through Whatman Grade 3 filter material and cleaned-up with C18-UltraMicroSpin columns (The Nest Group, Inc., Southborough, USA). The peptides were then dried and dissolved in 0.1 % Formic acid (FA) ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Albéric A. de Lajarte, et al.,
bioRxiv - Biochemistry 2024
Quote:
... adding a T7 promoter sequence at the forward primer (5′ TAATACGACTCACTATAG 3′) using a 2X PCR PreMix (Syd Labs, Cat. MB067-EQ2N), human cDNA (ZYAGEN ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...