-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Amrita Das Gupta, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-IBA1 (polyclonal rabbit) antibody (Fujifilm – Cellular dynamics; #019-19741; dilution 1:250), Anti-S100ß (polyclonal chicken ...
-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... or proteinase 3 (Elastin Products Company) (all 1 μM) ...
-
No products found
because this supplier's products are not listed.
Daiana Martire-Greco, et al.,
bioRxiv - Immunology 2021
Quote:
... conditioned media (CM) were collected and incubated for 2 h with an anti-Stx antibody (anti-Stx2 variant from Toxin Technology, USA) to block the direct effect of Stx ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Amanda P. Waller, et al.,
bioRxiv - Pathology 2020
Quote:
... membranes were incubated overnight at 1:2000 in primary antibody (Anti-murine Prothrombin, Haematologic Technologies Inc, Essex Junction, VT) followed by corresponding secondary antibody conjugated to horseradish peroxidase ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Shoib S. Siddiqui, et al.,
bioRxiv - Immunology 2020
Quote:
... or 3’-sialyllactose-PAA-biotinylated (Glycotech, Catalogue number-01-038), diluted in binding buffer ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Kevin Burbidge, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The grid was then probed with donkey anti-mouse antibody conjugated to 20nm gold particles 1:200 (Cytodiagnostics #AC-20-02), diluted in block solution for 30 minutes by flotation ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Hannah M. Starnes, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... PFOS (CAS 2795-39-3, purity ≥ 98%) was from Matrix Scientific (Columbia, SC), and 1H,1H,2H,2H-perfluorooctanol (6:2 FTOH ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Sabrina Haas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All antibodies were diluted in antibody diluent (IW-1000, IHC World, LLC, Woodstock, MD, USA) and incubated for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Cameron L. Woodard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Pipettes (3-5Ω) were pulled from borosilicate glass capillaries using a micropipette puller (Narishige International). The intracellular solution was cesium-based and contained the following in mM ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Kantak, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The 3-inch ballpoint sipper tube with a 1-inch bend (Ancare Corp., Bellmore, NY, USA) protruded 3.6 cm into the chamber ...
-
No products found
because this supplier's products are not listed.
Lauren T. Gill, et al.,
bioRxiv - Biochemistry 2022
Quote:
... except for an ubiquitin specific primary antibody (1:1000 dilution; UBCJ2, Mono- and polyubiquinated conjugates monoclonal antibody, FroggaBio).
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2019
Quote:
... The most concentrated fractions (3 ml total) were pooled and mixed with SUMO Protease (MCLAB, CA, USA) and provided SUMO buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Renee J. Tamming, et al.,
bioRxiv - Neuroscience 2019
Quote:
Brains from 3-month-old mice were stained using the FD Rapid GolgiStain Kit (FD Neurotechnologies, Inc). They were then flash frozen and sectioned on a cryostat at 100µm thickness and further processed as per kit instructions ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
Cells were seeded (3×105) in 35 mm glass-bottom dishes (WillCo Wells BV, Amsterdam, The Netherlands) with 2 ml of culture medium and maintained at 37°C and 5% CO2 for 24 prior to transfection (vide infra ...
-
No products found
because this supplier's products are not listed.
Adrian T. Press, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1,2-Dipalmitoyl-sn-glycerol-3-phosphoethanolamine (DPPE) azide was conjugated to DY-635-alkin (Dyomics GmbH, Jena, Germany) and used to prepare liposomes using a 100 nm extruder ...
-
No products found
because this supplier's products are not listed.
Susan D’Costa, Matthew J. Rich, Brian O. Diekman,
bioRxiv - Bioengineering 2019
Quote:
... with TRIzol™ and homogenized at 6500 rpm × 30 seconds for 3 cycles (Precellys® 24, Bertin Corp). Protein concentration was determined using the Micro BCA Protein assay kit (Thermo Fisher ...
-
No products found
Tam Vo, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The expression and purification of the HNRNPH1 truncated proteins qRRM1-2 and qRRM2-3 (Creative BioMart, Shirley, NY) were performed as described previously (23) ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Ashley Kidwell, et al.,
bioRxiv - Physiology 2021
Quote:
... Y-3 hybridoma cells (ATCC HB-176) were incubated in a membrane cell culture flask following the manufacturer’s instructions (Wheaton CELLine Bioreactor Flask and Hybridoma-SFM ThermoFisher 12045076) ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Nao Nishida-Aoki, Taranjit S. Gujral,
bioRxiv - Cancer Biology 2021
Quote:
Jurkat cells were washed with PBS and seeded onto a 24-well transwell culture insert with 3 µm pores (Celltreat Scientific Products ...
-
No products found
because this supplier's products are not listed.
Sujatha Muralidharan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A normal tissue TMA consisting of different organ specimens from 3 unique individuals was sourced from US Biomax (Cat# FDA999w1).
-
No products found
because this supplier's products are not listed.
Hao Wu, et al.,
bioRxiv - Cell Biology 2019
Quote:
PWS-IC methylation was analyzed by pyrosequencing of the intron 3 in human SNRPN gene (EpigenDX, Assay ID: ADS265-RS1), an established assay to determine the methylation status of PWS-IC (White et al. ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... parasites were grown in vitro at 37°C in solutions of 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, Winchester, VA) in RPMI 1640 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Matthieu Fritz, et al.,
bioRxiv - Microbiology 2023
Quote:
... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... we grew parasites at 37°C in vitro at 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, VA or BioIVT, NY) in RPMI 1640 medium (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kirsten L. Viola, et al.,
bioRxiv - Neuroscience 2021
Quote:
... antibodies mentioned above were conjugated with DOTA-NHS-ester (Macrocyclics, Dallas, TX) and then radiolabeled with 64Cu.
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Membranes were overnight probed in 1/1000 Rabbit Anti-Human APOBEC3G (Immunodiagnostics Inc.), washed three times ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...