-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Charlene J. Miller, et al.,
bioRxiv - Microbiology 2023
Quote:
... an ELISA kit from Life Diagnostics (West Chester, PA). Assays were completed according to the manufacturer’s recommended protocols and all samples were assessed in duplicate ...
-
No products found
because this supplier's products are not listed.
Hailong Guo, et al.,
bioRxiv - Microbiology 2023
Quote:
384 well ELISA plates were coated with 20µl of RBD (SARS-CoV-2 Omicron BA.1, ACROBiosystems) at 1µg/mL in PBS at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Luc H.J. Sondorp, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Secreted CEA was measured by chemiluminescent microparticle immunoassay (CMIA) using an Alinity CEA kit (Abbott Ireland Diagnostics).
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
Amino-acid additive stocks and selective plates with 5-FOA (GoldBio), hygromycin ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... and plate-bound α-CD3 (clone 145-TC11, 5 ug/ml; BioXCell) in complete RPMI medium supplemented with 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Clara Schmidt, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... are seeded in a 24-well plate (TPP, #92024) at 30-40k cells per well in E8 + ROCKi (5 µM Y-27632, Tocris #1254). All differentiation media are based on CDM that consists of 5 mg/ml bovine serum albumin (Europa Biosciences ...
-
No products found
because this supplier's products are not listed.
Shenghui Xing, et al.,
bioRxiv - Microbiology 2021
Quote:
... Chemiluminescent detection was performed using an ECL fluorescence colorimetric kit (Tiangen) and fluorescent signals were visualized using a Bio-Rad Gel Doc XR ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Nikolaus Frischauf, et al.,
bioRxiv - Immunology 2024
Quote:
... In a regular 96 ELISA flat bottom plate 15% normal human serum (Sanquin, Amsterdam, The Netherlands) was added to the liposome mixture (R1 from the kit ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Marc Fila, et al.,
bioRxiv - Pathology 2021
Quote:
... Corticosteroid clamp was achieved by bilateral adrenalectomy and supplementation with aldosterone (10 μg/kg/day) and dexamethasone (14 μg/kg/day) through subcutaneous osmotic pump (ALZET, Charles River) (Lourdel et al. ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
No products found
because this supplier's products are not listed.
Abigail E. Powell, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were washed 3X with PBST and blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA Buffer (Chondrex). ChonBlock was removed manually and plates were washed 3X with PBST ...
-
No products found
because this supplier's products are not listed.
Alessia Possenti, et al.,
bioRxiv - Microbiology 2022
Quote:
... and the LiteAblot Plus Enhanced Chemiluminescent Substrate (EuroClone).
-
5-Hydroxytryptophan (5-HTP, NSC-92523), also known as oxitriptan (INN), is a naturally occurring...
Cat# S2374, SKU# S2374-50mg,
50mg, $210.00
Ask
Satyaki Sengupta, et al.,
bioRxiv - Cancer Biology 2021
Quote:
5 x105 SH-SY5Y cells were seeded into 10 cm plates and treated with either 5 µM EED226 (Selleck Chemicals) or DMSO (vehicle control ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Jirina Zackova Suchanova, et al.,
bioRxiv - Plant Biology 2023
Quote:
... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
No products found
because this supplier's products are not listed.
Manmeet Bhalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... Bacterial titers were confirmed by plating on tryptic soy agar plates supplemented with 5% sheep blood agar (Hardy Diagnostics).
-
No products found
because this supplier's products are not listed.
Martijn Selten, et al.,
bioRxiv - Neuroscience 2023
Quote:
AAV8 viruses were produced in HEK293FT cells grown on 5 plates (linear PEI, Polysciences Europe Cat. No. 23966-100) or 10 plates (branched PEI ...
-
No products found
because this supplier's products are not listed.
Michael Ronzetti, et al.,
bioRxiv - Biochemistry 2022
Quote:
The DSF assay plate was constructed by dry-spotting 5 nL of SYPRO Orange with an acoustic dispenser (Echo 555, Labcyte) into a 384-well PCR plate ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
No products found
because this supplier's products are not listed.
Laura Mòdol, Monika Moissidis, Oscar Marín,
bioRxiv - Neuroscience 2023
Quote:
... a custom-made head plate containing a 5 mm diameter hole was fixed to the skull using veterinary adhesive (Vetbond, 3M). Once the head plate was fixed and stabilized ...
-
Cat# HY-113313-5 mg,
5 mg, USD $425.0
Ask
Konsta Karttunen, et al.,
bioRxiv - Genomics 2022
Quote:
... GP5d cells were seeded in 6 well plates and treated with 500 nM/L 5-aza-2’-deoxycytidine (MedChemExpress, HY-A0004) or DMSO (Fisher ...
-
No products found
because this supplier's products are not listed.
Randy Yoo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 96-well plate low volume crystallization plates (Hampton Research) were all set up at room temperature using sitting drop method with ratios 1:1 and 1:2 for precipitant to protein ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Surya D. Aggarwal, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cultures were incubated statically at 37°C with 5% CO2 followed by plating on TSA plates supplemented with 100 µl of catalase (38,000 U/ml; Worthington Biochemical Corporation, NJ) and the desired antibiotic (250 µg/ml kanamycin or 200 µg/ml streptomycin) ...
-
No products found
because this supplier's products are not listed.
Simone Vormittag, et al.,
bioRxiv - Microbiology 2022
Quote:
... infected cells (including supernatant) were collected from the 6-wells plate, centrifuged (500× g, 5 min, RT) and fixed with 4% PFA (Electron Microscopy Sciences) for 30min at RT ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Julia A Alvarez, et al.,
bioRxiv - Microbiology 2024
Quote:
... 100 or 300 tachyzoites were plated in HFF monolayers grown in a 24-well plate and 4-6 days later were counted by microscopy (4x objective) (Nikon Eclipse Ti-5).
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5-bromosalicylic acid (5-BAA) (>98.0%; TCI), isopropyl β-D-1- thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Andrea Rizzotto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 5 μL of 5 μg/mL Propidium Iodide (Biotium) for cell death detection ...
-
No products found
because this supplier's products are not listed.
Régis E Meyer, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or 1-NMPP1 (5 μM, Calbiochem; 5 mM stock in dimethylsulfoxide) were added to the medium at the time of prophase exit ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Adnan K. Syed, et al.,
bioRxiv - Microbiology 2020
Quote:
... Once the biofilms were grown for 24 hours they were washed three times with 200 μl of PBS at pH 7.5 and then resuspended in 200 μl of PBS at pH 7.5 and transferred to a filter plate (0.2-μm AcroPrep Advance 96-well filter plates no. 8019; Pall). 100 μl of the filtrate was then combined with 100 μl of 2 μM SYTOX Green (no ...
-
No products found
because this supplier's products are not listed.
Wei-Ping Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human BMPR2 ELISA Kit (orb406355, Biorbyt, United Kingdom) was used to detect the level of soluble BMPR2 in serum ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Manuel Gehl, et al.,
bioRxiv - Biochemistry 2023
Quote:
All crystallization experiments were carried out in an anaerobic chamber with a 95%/5% (N2/H2) atmosphere using the sitting drop vapor diffusion method and 96-well two-drop MRC crystallization plates (Molecular Dimensions). The plates were incubated for one week in the chamber before use ...
-
No products found
because this supplier's products are not listed.
Fabian S. F. Hartmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The working plate (96-well plate) was used as a source plate for robotic spotting using a ROTOR HDA benchtop robot (Singer Instruments, United Kingdom) on rectangular OmniTray plates (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
David M. Zong, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... An aluminium plate seal (Diversified Biotech) was applied and the plate was frozen at -20 °C.
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)