1 - 50 of 525
suppliers found for
Aldosterone Chemiluminescent ELISA Kit 5 Plate
» view 10000+ matched products-
Arbor Assays Sponsored
Aldosterone Chemiluminescent ELISA / assay KitCat# K052-C5, 1.0 ea, USD $1380.0 Ask
-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020, published in Parasitologia doi: 10.3390/parasitologia1010001Quote: ... Plates were coated with 5 μg/ml TciALDO onto ELISA plates (Maxisorp, Thermofisher Scientific) overnight at 4 °C ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: Enhanced ELISA plates (Corning) were coated with diluted anti-IFNγ antibodies (2 μg/mL ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2018Quote: ... High sensitivity GLP-1 active chemiluminescent ELISA kit (Millipore Corp, Missouri) and high sensitive mouse insulin immunoassay ELISA kit (ImmunoDiagnostics Limited ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020, published in PLOS ONE doi: 10.1371/journal.pone.0231234Quote: ... Systemic aldosterone levels were measured by enzyme immunoassay (m/r/h Aldosterone ELISA; Enzo Life Sciences, Farmingdale, NY, USA) and serum osteopontin (OPN ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2021Quote: Pre-coated ELISA plates were purchased from R&D Systems and performed according to manufacturer instructions ... -
Greiner
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in Cell Reports doi: 10.1016/j.celrep.2019.08.050Quote: ... ELISA plates (Greiner) were coated with 5μg/mL anti-CD3/28 with the final volume of 100μL at 4°C for overnight ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018Quote: ... ATTR-D38A fibrils were immobilized on anti-TTR pre-coated well plates (Prealbumin ELISA kit, Abcam) as follows ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ... -
Alpco Diagnostics
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: ... and aldosterone (11-AD2HU-E01, Alpco, Salem, NH) were measured in serum using EIA kits validated for use in elephant seals (McCormley et al. ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Genome Medicine doi: 10.1186/s13073-018-0589-3Quote: Mouse IL-5 ELISA (BD Biosciences, 555236) -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in eLife doi: 10.7554/elife.42628Quote: ... concentrations measured using commercially available ELISA kits and an EL800 plate reader (BioTeK). Mice were housed in individual metabolic cages for 72 hours and urine collected for the final 24 hours ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... IL1β ELISA kit (BioLegend) was used to measure IL1β secreted into the supernatants ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Next morning plates were washed with an ELISA plate washer (ImmunoWash 1575, BioRad) using 0.25 mL wash solution/well (DPBS ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... chemiluminescent kit (Roche Applied Science). Chemiluminescence values were obtained with the use of a TECAN at 492 nm ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... ECL chemiluminescent kit (RPN2132, GE Healthcare) was used for detection according to manufacturer’s instructions. -
Mercodia
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA, #10-1247-01, Mercodia, Sweden) following manufacturer’s instructions in plasma sampled in the saphenous vein after the 6-hour fasting during the GTT test. -
Crystal Chem
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.2006578117Quote: ... ELISA kit (Crystal Chem Inc.) was used to measure plasma insulin levels ... -
MyBioSource
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in eLife doi: 10.7554/elife.42628Quote: ... aldosterone (Mybiosource) and atrial natriuretic peptide (Elabscience ... -
Cayman Chemical
No products found because this supplier's products are not listed.Cited in TMAO, a seafood-derived molecule, produces diuresis and reduces mortality in heart failure ratsbioRxiv - Physiology 2020, published in eLife doi: 10.7554/eLife.57028Quote: ... aldosterone (Cayman Chemicals, cat. no. 501090), vasopressin (Biorbyt ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2019, published in Matters doi: 10.19185/matters.201906000003Quote: ... ELISA plates were read at 450 nm on a plate reader (Molecular Devices). Specific concentrations for each sample were determined as mean absorbance using a standard curve of samples ranging from 0 to 8000 pg/ml. -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018Quote: ... Reagents used were: Chemiluminescent Western detection kit (Cell Signaling); cycloheximide (CHX ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Frontiers in Microbiology doi: 10.3389/fmicb.2019.02176Quote: ... total GLP-1 levels in cell supernatants were measured using High Sensitivity GLP-1 Active ELISA-Chemiluminescent (Merck Millipore, EZGLPHS-35K, Germany) according to the reports (38 ... -
Bethyl
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0218494Quote: ... Mouse albumin ELISA kit (Bethyl Lab, Hamburg, Germany), paraformaldehyde (Merck ... -
Elabscience Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Behavioural Brain Research doi: 10.1016/j.bbr.2019.112268Quote: ... Commercially available sandwich ELISA kits (Elabscience®, USA) were used to measure concentration of serum pTau protein (cat ... -
Qiagen
No products found because this supplier's products are not listed.Cited in Programmed genome editing of the omega-1 ribonuclease 1 of the blood fluke, Schistosoma mansonibioRxiv - Molecular Biology 2018, published in eLife doi: 10.7554/elife.41337Quote: ... which were provided in the ELISA kit (Qiagen). Three biological replicates were undertaken. -
Tecan
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0225869Quote: ... Absorbance was read at 550 nm in an ELISA plate reader (Sunrise, Tecan, Milan, Italy), and the results expressed as relative change with respect to the controls set as 100%. -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Frontiers in Physiology doi: 10.3389/fphys.2019.00556Quote: ... 5’-ATCGAGTGCGATCACAAGCAG-3’ (1st PCR) and 5’-ACTCTCAGATTCCGGATTCACC-3’ (2nd PCR) using 5’-Full RACE Kit (TAKARA). For the 3’ RACE ... -
BMG Labtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2017, published in Immunology and Cell Biology doi: 10.1111/imcb.12041Quote: ... ELISA plates were read using a FLUOstar Optima plate reader (BMG LabTech). -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... IL-8 ELISA kits were from Peprotech (London) -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in Nature Communications doi: 10.1038/s41467-019-13864-1Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ... -
Alpha Diagnostic
No products found because this supplier's products are not listed.Cited in Management of Hsp90-Dependent Protein Folding by Small Molecule Targeting the Aha1 Co-ChaperonebioRxiv - Biochemistry 2018, published in Cell Chemical Biology doi: 10.1016/j.chembiol.2020.01.008Quote: ... The Human PSA ELISA Kit (Alpha Diagnostic International, ADI) to quantify secreted PSA in the media was used ... -
Cell Biolabs
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... MDA-HDL ELISA kit was purchased from Cell Biolabs Inc ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in PLOS ONE doi: 10.1371/journal.pone.0222685Quote: ... 50 ul of the conditioned medium from each transfection was incubated in one well of a 96-well ELISA plate (UltraCruz® ELISA Plate, high binding, 96 well, Flat bottom, Santa Cruz Biotechnology) at 37°C for 1 hr to allow protein in the media to adsorb to the plates ... -
Arbor Assays
Aldosterone Chemiluminescent ELISA / assay KitCat# K052-C5, 1.0 ea, USD $1380.0 AskbioRxiv - Animal Behavior and Cognition 2018, published in Alcohol doi: 10.1016/j.alcohol.2018.10.002Quote: ... 5 μl plasma samples were processed with a commercially available colorimetric ELISA kit (Arbor Assays; Ann Arbor, MI), according to the manufacturer’s instructions ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in Genetics doi: 10.1534/genetics.118.301240Quote: ... Blots were developed using the LumiSensor Chemiluminescent HRP Substrate kit (Genscript USA ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... WesternSure PREMIUM Chemiluminescent Substrate (LI-COR) visualized the antigen in the Alpha Innotech Fluor Chem FC2 Imaging System. -
Promega
No products found because this supplier's products are not listed.Cited in Activation of the TRKB receptor mediates the panicolytic-like effect of NOS inhibitor aminoguanidinebioRxiv - Neuroscience 2018, published in Progress in Neuro-Psychopharmacology and Biological Psychiatry doi: 10.1016/j.pnpbp.2019.04.007Quote: The BDNF levels in the PAG samples were assessed by commercial sandwich ELISA kit (Promega, #G7610, USA) according to the manufacturer’s instructions ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Nature Biotechnology doi: 10.1038/s41587-019-0150-yQuote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit), a 3 nt UMI (unique molecular identifier) ... -
Boster
No products found because this supplier's products are not listed.bioRxiv - Pathology 2019Quote: ... Serum IL1β was detected by Elisa kit (Boster Biological Technology). -
Abnova
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... Plasma insulin level was obtained using Insulin (Mouse) ELISA Kit (Abnova). Acetyl Co-A levels in the liver and cells were obtained using the Acetyl-CoA Fluorometric Assay Kit (Biovision). -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Translational Research doi: 10.1016/j.trsl.2020.09.003Quote: Immunoglobulins (Ig) in culture supernatants were measured using a human IgG ELISA development kit (Mabtech) according to manufacturer’s instructions ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for additional 20 min allowing cells to settle on the pre-dispensed gel ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in Journal of Virology doi: 10.1128/jvi.01526-18Quote: ... The chemiluminescent was determined by using the DTX 880 plate reader (Beckman Coulter). Data points were analyzed using Prism software and the 50% inhibition concentration (IC50 ... -
RayBiotech
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... mouse insulin ELISA kit (cat # ELM insulin, RayBiotech GA) and rat/mouse c-peptide ELISA kit (cat # EZRMCP 2-21K ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in Cell Stem Cell doi: 10.1016/j.stem.2018.07.004Quote: ... Mycoplasma detection tests were conducted routinely every month with MycoALERT ELISA based kit (Lonza) to exclude mycoplasma free conditions and cells throughout the study. -
Sarstedt
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in The Journal of Experimental Biology doi: 10.1242/jeb.185884Quote: ... and 100 µL of this antibody solution was applied into each well of a high-binding 96-well ELISA plate (Sarstedt Inc., Montreal, QC) and incubated overnight at 4°C ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... A 5′ Cy5 fluorescent label was incorporated using the 5′ EndTag kit (Vector Labs) according to the manufacturer’s instructions ... -
Eppendorf
No products found because this supplier's products are not listed.Cited in Protein aggregation capture on microparticles enables multi-purpose proteomics sample preparationbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.TIR118.001270Quote: ... 5% TFA) was added to eluted peptide mixture in Protein LoBind 96 well plate (Eppendorf) at 1:1 volume ratio ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019Quote: ... 5% CO2 and ambient oxygen level on Geltrex coated plates in mTeSR1 medium (STEMCELL Technologies, 05850) with daily medium change ...