-
No products found
because this supplier's products are not listed.
Jeeyun Chung, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit monoclonal anti-ATG7 (Cell Signaling Technology), chicken polyclonal anti-MAP2 (Synaptic Systems) ...
-
No products found
because this supplier's products are not listed.
H.-Heinrich Hoffmann, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... rabbit anti-ATG7 (Abcam: ab52472; RRID: AB_867756; 1:50,000), rabbit anti-LC3B (Abcam ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... 1:2000 rabbit anti-ATG7 (Sigma-Aldrich), 1:2000 rabbit anti-P62 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Swagatika Paul, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Vinculin Rabbit mAb (# 700062; Invitrogen), p-H3 Rabbit mAb (S10 ...
-
No products found
because this supplier's products are not listed.
Peigang Liang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-ATG7(Abclonal; A19604), rabbit anti-ATG13 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Sukhleen Kaur, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ATG7 (Santa Cruz Biotechnology-SC-33211), ATG13 (CST-D4P1K) ...
-
No products found
because this supplier's products are not listed.
John T. Killian Jr., et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant human IgG1 mAbs were synthesized (Sino Biological) using the AA sequences derived from the predicted UCA nucleotide sequences.
-
No products found
because this supplier's products are not listed.
Darrell R. Kapczynski, et al.,
bioRxiv - Microbiology 2021
Quote:
... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
No products found
because this supplier's products are not listed.
Zoya Mann, et al.,
bioRxiv - Cell Biology 2023
Quote:
Rabbit mAb against NMIIB (Biolegend, Cat#909901)
-
No products found
because this supplier's products are not listed.
Laurelle Jackson, et al.,
bioRxiv - Microbiology 2021
Quote:
... a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody ...
-
No products found
because this supplier's products are not listed.
Swagatika Paul, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Optineurin Rabbit mAb (#10837-1-AP; Proteintech), NDP52 (60732 ...
-
No products found
because this supplier's products are not listed.
Cemil Kerimoglu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... NESTIN mouse mAb (BD), RC2 mouse mAb (Developmental Studies Hybridoma Bank),
-
No products found
because this supplier's products are not listed.
Hataf Khan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
No products found
because this supplier's products are not listed.
Stefanie Jehle, et al.,
bioRxiv - Systems Biology 2021
Quote:
... secondary mAB anti-rabbit (donkey, GE Healthcare, LNA934V);
-
No products found
because this supplier's products are not listed.
Ingrid R. Niesman,
bioRxiv - Cell Biology 2020
Quote:
... (Abcam; CHOP mAb #2895T, GFP rabbit mAb #2956T Novus Biologicals; TGN38 mAb #NB300-575SS ...
-
No products found
because this supplier's products are not listed.
Benedetta Mattorre, et al.,
bioRxiv - Biochemistry 2022
Quote:
... anti-ERAP2 (mAb clone 3F5, MAB 3830 R&D Systems) (25) ...
-
No products found
because this supplier's products are not listed.
Tomoaki Sobajima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CENP-A (mouse mAb, AbCam, ab13939; mouse mAb, GeneTex, GTX13939), CENP-C (guinea pig pAb ...
-
No products found
because this supplier's products are not listed.
Anngela C. Adams, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... κ isotype control mAb (BioXCell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Eloise Clarkson, Annabelle Lewis,
bioRxiv - Cancer Biology 2024
Quote:
... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
No products found
because this supplier's products are not listed.
Dorothea Höpfner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
No products found
because this supplier's products are not listed.
Ekapot Singsuksawat, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then intracellularly stained with 4G2 mAbs followed by rabbit anti-mouse Igs FITC (Dako). The cells were fixed with 1% formaldehyde and analyzed on BD LSRFortessa ...
-
No products found
because this supplier's products are not listed.
Salim T. Islam, et al.,
bioRxiv - Microbiology 2020
Quote:
... Detection via secondary antibody was done with goat α-rabbit mAb (1:5000) conjugated to HRP (Biorad). Immunoblots were developed using the SuperSignal West Femto (Thermo ...
-
No products found
because this supplier's products are not listed.
Stephanie U. Greer, et al.,
bioRxiv - Genomics 2019
Quote:
... expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1) expressing ATG7 isoform 1 was derived from pCMV-myc-Atg7(2) using the Q5 site-directed mutagenesis kit (NEB, Ipswich, MA). Subsequently ...
-
No products found
because this supplier's products are not listed.
David Sitbon, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... we produced recombinant H3 mutant proteins from mRNAs using rabbit reticulocyte lysate (Promega L4600). After 3h of incubation at 4°C in interphase extracts followed by another 3h incubation with anti-HA beads ...
-
No products found
because this supplier's products are not listed.
Yuhao Wang, Linhao Ruan, Rong Li,
bioRxiv - Cell Biology 2023
Quote:
... mAb clone JL-8 (632381) from Takara Bio ...
-
No products found
because this supplier's products are not listed.
Nina Kirstein, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rabbit anti-H4K20me3 (Diagenode, MAb-057-050), or IgG isotype controls for 16h at 4°C ...
-
No products found
because this supplier's products are not listed.
Clément Demongin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Primary antibodies for FUS (α-FUS rabbit, mAB ABnova) and TDP-43 (α-TDP-43 mousse ...
-
No products found
because this supplier's products are not listed.
R Ragazzini, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... H3 mAb (39163) and H3K27me2 mAb (61435) were purchased from Active Motif. Polyclonal Rabbit one against H3 from Cell Signaling Technology (9715) ...
-
No products found
because this supplier's products are not listed.
Mohammad M. Sajadi, et al.,
bioRxiv - Immunology 2021
Quote:
... 0.5 μg/mL anti-CD40 mAb (Miltenyi Biotec) and CXCR5 antibody were added ...
-
No products found
because this supplier's products are not listed.
Stephanie U. Greer, et al.,
bioRxiv - Genomics 2019
Quote:
The plasmid pCMV-myc-Atg7(2) expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1 ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
... Mab MT57 (Mabtech), were absorbed on plates instead of spike antigen ...
-
No products found
because this supplier's products are not listed.
Katarzyna Olga Rojek, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human recombinant VEGF-165 (Stemcell technologies; Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Krisztina Ötvös, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The purified recombinant protein was used to immunize rabbits by a company (Eurogentec). From the immunserum a crude IgG fraction was isolated by ammonium sulfate precipitation then IgG was further purified on protein gel blots of the antigen ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Plant Biology 2021
Quote:
... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
No products found
because this supplier's products are not listed.
Kostantin Kiianitsa, Nancy Maizels,
bioRxiv - Biochemistry 2020
Quote:
... a rabbit polyclonal raised against recombinant PARP1 (Enzo Life Sciences ALX-210-302-R100; 1:4000 dilution); anti-N-ter-PARP1 ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant mouse IFNγ (Immunotools, #12343537), recombinant mouse IL4 (Immunotools ...
-
No products found
because this supplier's products are not listed.
Heike Seybold, et al.,
bioRxiv - Plant Biology 2024
Quote:
... primary antibodies (anti-GFP: Abcam ab290; anti-NBR1: Agrisera AS142805; anti-ATG7: Agrisera AS194277) from rabbit were used in combination with a secondary HRP-conjugated anti-rabbit antibody from goat ...
-
No products found
because this supplier's products are not listed.
Ivan Martinez-Valbuena, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant α-synuclein (rPeptide) was thawed from −80 ◦C storage ...
-
No products found
because this supplier's products are not listed.
Melissa Lim, et al.,
bioRxiv - Biochemistry 2024
Quote:
Recombinant DCAF16 (MyBioSource.com, MBS1375983) (0.1μg/sample ...
-
No products found
because this supplier's products are not listed.
Tania Christova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant GST (SignalChem #G52-30U) and GST-LTK (SignalChem #L11-11G ...
-
No products found
because this supplier's products are not listed.
Awadalkareem Adam, et al.,
bioRxiv - Immunology 2021
Quote:
... Human recombinant ACE2-Fc-tag (Raybiotech) was then added at 1 μg/mL and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Kelsey Briggs, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
Hsuan-Yuan (Sherry) Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... 2M7 mAb isolated from rabbit PBMCs was detected with an HRP-conjugated polyclonal mouse anti-rabbit IgG (Southern Biotech) and all the positive controls were detected with an HRP-conjugated polyclonal goat anti-human IgG (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
David Gonzalez-Perez, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Secondary antibody anti-Rabbit IgG conjugated to HRP (Goat mAb, Vector Laboratories, 1:8,000) was used for detection of proteins using SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Martin Pauli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... rabbit polyclonal and mAb anti-Zinc transporter 3 (ZnT3) (Synaptic Systems 197 002 and 197 011, 1:500). Secondary antibodies were used in the following concentrations ...
-
No products found
because this supplier's products are not listed.
Vien Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CC1 (APC, Mouse Mab OP80, Calbiochem), Nkx2.2 (Mouse Mab 74.5A ...
-
No products found
because this supplier's products are not listed.
Maria Tello-Lafoz, et al.,
bioRxiv - Immunology 2020
Quote:
... ECD-labeled anti-CD56 mAb (Beckman Coulter), BV650-labeled anti-CD3 mAb (clone UCHT1 ...
-
No products found
because this supplier's products are not listed.
Katrina Forrestall, et al.,
bioRxiv - Microbiology 2023
Quote:
... Recombinant PLpro (BPS Biosciences, 100735) was provided in a formulation of 40 mM Tris-HCl buffer (pH 8) ...
-
No products found
because this supplier's products are not listed.
Wai Tuck Soh, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti-rat IgG-APC mAb (Jackson ImmunoResearch, West Grove, PA, USA).