Labshake search
Citations for Qiagen :
1 - 50 of 115 citations for ATG7 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Cell Biology 2022Quote: ... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant plasmids were then isolated (MiniPrep, Qiagen) and sequenced (DNA Sequencing Facility ...
-
bioRxiv - Cell Biology 2019Quote: ... Alexa Fluor 647-conjugated Penta-His mAb was purchased from Qiagen, Germantown ...
-
bioRxiv - Microbiology 2022Quote: ... the membrane was treated with Penta-His MAb (Qiagen, Germantown, MD) followed by HRP-conjugated goat anti-mouse IgG (Invitrogen ...
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Plant Biology 2021Quote: ... recombinant protein and purified using Ni-NTA resin (Qiagen). Polyclonal antibodies were raised in mice as described in 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant protein was purified using Ni-NTA agarose (Qiagen). Rabbit polyclonal antibodies were generated by Covance ...
-
bioRxiv - Developmental Biology 2020Quote: ... recombinant proteins were purified using Ni-NTA Agarose (Qiagen 30210). Buffer was exchanged by dialysis to PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... Recombinant proteins were purified using Ni-NTA affinity resin (Qiagen) according to standard protocols (21) ...
-
bioRxiv - Biophysics 2023Quote: ... The recombinant proteins were purified using nickel affinity chromatography (Qiagen). As the final purification step ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant proteins were then purified by Ni-NTA-agarose (Qiagen) affinity chromatography ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant proteins were purified with Ni-NTA chromatography (Ni2+-nitrilotriacetate, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant plasmids were purified with EndoFree Plasmid Maxi Kit (12362, QIAGEN). Oligonucleotide sequences and further details are provided in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant protein was initially purified by nickel affinity chromatography (Qiagen, Holland) and subsequent size exclusion using Superdex 200 increase (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Uhrf1 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 40,920 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Swi6 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 45,330 cm-1 M-1) ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant HCMVs were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 cells.
-
bioRxiv - Immunology 2023Quote: ... Recombinant protein was purified by binding to Ni-NTA beads (Qiagen) and eluted in the same buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Ni2+-nitrilotriacetic acid agarose beads (Qiagen) and desalted with Bio-Gel P-6DG gel (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... the recombinant protein was purified by Ni-NTA affinity chromatography column (QIAGEN).
-
bioRxiv - Microbiology 2019Quote: ... Recombinant protein in the supernatant was purified via Ni2+-NTA (Qiagen, UK) column [20].
-
bioRxiv - Biophysics 2021Quote: ... The recombinant proteins were purified from lysates on Ni-NTA columns (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Bioengineering 2023Quote: ... Recombinant plasmids were prepared by using the QIAprep Spin Miniprep Kit (QIAGEN) and confirmed by sequencing analysis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plates were coated with 100 μL of 4 μg/mL murine anti-His mAb (Qiagen, #34660), and after blocking ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were affinity purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) and elution with imidazole ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The recombinant proteins were purified under denaturing conditions on Ni-NTA agarose (Qiagen). The purified proteins were used for rat immunization in an in-house animal facility at the Charles University.
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cell Biology 2023Quote: ... Preparation of his-tagged recombinant proteins was performed according to manufacturer instructions (Qiagen). Preparation of GST-tagged recombinant proteins was performed according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... under p32 promoter to the recombinant expression using PCR Cloning Kit (Qiagen, Germany). The recombinant plasmids were named as pMG36e:nisA (nisA) ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Nickel sepharose according to the manufacturer’s instructions (QIAGEN). The purified recombinant protein was dialyzed overnight against dialysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... The recombinant TDP-43 proteins were purified over Ni-NTA agarose beads (Qiagen) and eluted using 50 mM HEPES (pH 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... Poly-histidine-tagged recombinant proteins were purified using Ni-NTA-Agarose (Qiagen, Hilden, Germany) beads according to manufacturer’s instructions and were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Molecular Biology 2019Quote: ... recombinant protein was enriched via a Ni+2-nitroloacetic acid column (Ni-NTA; Qiagen), as described previously (Edwalds-Gilbert et al ...
-
bioRxiv - Microbiology 2019Quote: ... The recombinant protein was purified by incubation with Qiagen Ni-NTA agarose beads (Qiagen) for 1 h followed by three washing steps with the lysis buffer before elution with lysis buffer containing increasing concentrations of imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... Preparations of recombinant plasmids were conducted using the QIAprep Spin Miniprep Kit from QIAGEN, and then these plasmids were sequenced by BGI Group (Genome Sequencing Company) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant HisCheY or HisCheY* and bound proteins were purified using nickel agarose columns (Qiagen) under native conditions per manufacturers’ instructions.
-
bioRxiv - Bioengineering 2020Quote: ... and recombinant proteins were isolated from the periplasmic fraction using Ni-NTA beads (Qiagen). Following washing and subsequent elution with 50 mM Tris (pH 8) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant MBP-Dnmt5(345-747)-6xHis was purified using Ni-NTA agarose resin (Qiagen) and measured by A280 (ε = 139,790 cm-1 M-1).
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant GST-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 66,030 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant MBP-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 89,590 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant TDP-43 was purified using the Ni-NTA SpinColumn purification kit (31014, Qiagen), essentially according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence-verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant proteins produced in the supernatant were purified using Ni-NTA agarose (QIAGEN). To biotinylate RBD proteins ...
-
bioRxiv - Cell Biology 2022Quote: Constructs for recombinant bacterial protein expression were all cloned in the pQE plasmid (Qiagen). Su9-DHFR and CaM-3C-Alfa-Sec61β(2–60)-OMP25(112–145)F128Amber were cloned downstream of a His14-bdSUMO tag ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified according to manufacturer’s instructions by Ni2+-NTA agarose beads (QIAGEN). Washing steps were performed with a buffer containing 20 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 mM imidazole and the recombinant V0c was purified over Ni-NTA beads (QIAGEN).