-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Valentin Gfeller, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Each plot was 6 m long and 3 m wide and separated from each other by 3 m of buffer of alfalfa (Medicago sativa). Maize was grown from Mai to September 2018 followed by wheat from October to July 2019 ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
PAR-3 (1-6) is a peptide.
Cat# abx265070-25MG,
25 mg USD $536.5
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
Cat# G209,
USD $10.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
Mouse monoclonal antibody specific for Dengue membrane, virus type 1, 2 and 3
Cat# MAB12182-500,
500µg USD $762.6
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Abdulbasit Amin, et al.,
bioRxiv - Physiology 2022
Quote:
Blood was collected from 6 – 7 h fasted mice to quantify the concentration of insulin in the serum using an insulin ELISA kit (ALPCO). The medium of adipocytes was cleared and used to evaluate the levels of TNF ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Franziska Hentzschel, et al.,
bioRxiv - Microbiology 2023
Quote:
... the salivary gland sporozoite suspension was topped up to 1 ml with RPM and then carefully underlaid with 3 ml of 17 % Accudenz (in dH2O, Accurate Chemical & Scientific Corp., Westbury, NY, USA). Centrifugation for 20 min at 2800 rpm and at room temperature without break separated sporozoites from cell debris ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Fluorescence of hydrolyzed K63-linked diUb (TAMRA/QXL position 3 labeled, Boston Biochem #UF-330) was measured on a BioTek synergy LX plate reader equipped with a red filter cube assembly (ex ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Trevor M Nolan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... plated on 1/2 Linsmaier and Skoog (LSP03-1LT, Caisson Labs; pH 5.7), 1% sucrose media ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... serum was diluted 1/200 and then applied to HEp-2 slides (Antibodies Incorporated or BD). Staining was detected using goat anti-mouse IgG FITC at 1:500 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...