-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Mary E. Law, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated with 0.5 mg/mL MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Biomatik, Wilmington, DE USA) in PBS for 3 h ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... ACC 635) and U2OS 2-6-3[67] cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech, catalog no. P04-03550) completed with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Kailash Venkatraman, et al.,
bioRxiv - Biophysics 2023
Quote:
... Cells were back-diluted 1:100 in fresh CSM containing 2% glucose or 3% glycerol and shaken in a plate reader (Tecan) for 48 hours ...
-
No products found
because this supplier's products are not listed.
Rafaela Muniz de Queiroz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-integrin alpha-3 (cat#A02902) and anti-integrin alpha-2 (cat#A01933-2) were purchased from Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Andrea Mohr, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... multimeric FasL and anti-APO-1-3 from AdipoGen Life Sciences (San Diego ...
-
No products found
because this supplier's products are not listed.
Melis D. Arslanhan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti Centrin-3 (1:1000, Abnova, H8141-3EG), mouse anti V5 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 400μM 3-isobutyl-1-methylxanthine (IBMX; 2885842; BioGems) for two days then replaced by a supporting medium (SM) ...
-
No products found
because this supplier's products are not listed.
Anja Kopp, et al.,
bioRxiv - Biochemistry 2023
Quote:
Screening of crystallization conditions for wild type GSDMD and GSDMDΔ184-194/Δ247-272 in complex with nanobodies VHHGSDMD-1 to VHHGSDMD-6 and the combination of VHHGSDMD-2 plus VHHGSDMD-6 was performed using commercial kits from Molecular Dimensions (Maumee, OH, USA) and Jena Bioscience (Jena ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Kate L. Vasquez Kuntz, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3 mM MgCl (Bioline, Boston, MA), 1 mM dNTP (Bioline ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... on the metabolic activity of primary neurons were evaluated using the tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Trevigen, Gaithersburg, MD), a colorimetric test based on the enzymatic activity of NADPH-dependent cytoplasmic oxidoreductase enzymes that catalyze the reduction of the membrane permeable MTT into colorimetric formazan products ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Yuuki Wittmer, et al.,
bioRxiv - Biophysics 2022
Quote:
... ∼6 mL using Millipore Amicon Ultra-15 3 kDa MWCO centrifugal filter and dialyzed (Spectrum Laboratories 1.7 ml/cm standard SpectraPor 1 RC Tubing ...
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were washed 3 times in PBS and incubated for 2 h with adequate secondary antibody (Dianova, Hamburg, Germany; Table 1) solution without Triton™-X-100 ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Takuya Yoshida, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and with varied length varied (3-6 mm depending on the place) (RWD Life science Inc, US and Doric Lenses, Canada). The fiber probe was secured by adhesion bond (Loctite 454 ...
-
No products found
because this supplier's products are not listed.
Shinya Komata, et al.,
bioRxiv - Genetics 2022
Quote:
... by QuantStudio 3 (ABI). The detailed method was followed by Iijima et al ...
-
No products found
because this supplier's products are not listed.
Ziliang Zhao, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
Kristen Mehalko, et al.,
bioRxiv - Genetics 2022
Quote:
... The tissue was homogenized using a BeadBug 6 microtube homogenizer for 3 rounds of 30 seconds at 3000 rpm (Benchmark Scientific, 422V16). RNA was purified from homogenized tissue using the Direct-Zol RNA Miniprep kit (Zymo Research ...
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
Rebecca L. Pinals, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Solutions were probe-tip sonicated for 10 minutes in an ice bath (3 mm probe tip set at 50% amplitude, 5-6 W, Cole-Parmer Ultrasonic Processor). Samples were centrifuged to pellet insoluble SWCNT bundles and contaminants (16,100 cfg for 30 minutes) ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...
-
No products found
because this supplier's products are not listed.
Casimir Bamberger, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 2xStrep tagged SARS-CoV-2 ORFs were immunoprecipitated using 30 μl of Megastrep type 3 XT beads (IBA LifeSciences, Germany), and flag-tagged SARS-CoV-2 ORFs were immunoprecipitated using Anti-DYKDDDDK Magnetic Agarose (Pierce ...
-
No products found
because this supplier's products are not listed.
M. Nabuan Naufer, et al.,
bioRxiv - Biophysics 2019
Quote:
The 8.1 kbp dsDNA construct with a primer-template junction at one terminus was tethered between 2 μm anti-digoxigenin and 3 μm streptavidin functionalized beads (Spherotech) held in place by a micropipette tip and a dual beam optical trap ...
-
No products found
because this supplier's products are not listed.
Xuesong Li, et al.,
bioRxiv - Cell Biology 2022
Quote:
... MEFs were washed extensively and GFP-booster (tagged with Alexa488, ChromoTek, gb2AF488-50, 1:500 in 3%BSA/PBS) and anti-rabbit-Alexa568 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
R. Benjamin Free, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 5,6,7,8-tetrahydro-6-[(2-phenylethyl)propylamino]) derivative labeled with a red fluorescent probe (PPHT-red) was obtained from Cisbio Bioassays (Bagnolssur-Cèze ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Denis Antonets, et al.,
bioRxiv - Cell Biology 2019
Quote:
... TagRFP fragment without start codon was obtained by PCR with TagRFP-woATG-F 5’-GT CGGTACCGTGTCTAAGGGCGAAGAGCTG-3’ n BFPX3-R 5’-GCGCTTAAGTTAATTAAGCTTGTGCCCCA-3’ primers and pTagRFP-N vector (Evrogen) as a DNA source ...
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... proSAAS (AAV 2/6; Vigene Biosciences) or enhanced green fluorescent protein (GFP; AAV 2/6; Vector Biolabs) was driven by the human SYN1 promoter ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... (4-(1,2,4,5-tetrzain-3-yl)phenyl)methanamine (tetrazine amine) was purchased from Kerafast (FCC659, lot: 2014). 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Allen G. Sanderlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 2 × 105 recipient cells/well (A549) in 6-well plates (Genesee Scientific) were reverse transfected with 5 nM siRNA using Lipofectamine RNAiMAX (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Elia Obis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-ketoacyl-CoA thiolase (MyBioSource MBS1492126) used at a dilution of 1/100 ...
-
No products found
because this supplier's products are not listed.
Bailey AT Weatherbee, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... cells were passaged to mitomycin-C inactivated CF-1 MEFs (3×103 cells/cm2; GSC-6101G, Amsbio) in media consisting of DMEM/F12 with 20% Knockout Serum Replacement (10828010 ...
-
CytoSoft® products provide a tool to culture cells on PDMS substrates with various rigidity...
Cat# 5141-5EA,
6 well, USD $160.0
Ask
Manabu Shiraishi, Ken Suzuki, Atsushi Yamaguchi,
bioRxiv - Molecular Biology 2022
Quote:
... Cardiac fibroblasts (2 × 104) were plated on a 0.1% gelatin-coated CytoSoft 6-well dish (Advanced Biomatrix) and cultured for 24 hours in DMEM containing 2% FBS ...