-
No products found
because this supplier's products are not listed.
Mathieu Paquette, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated for either 24 h or 7 days in medium containing one or a combination of the following reagents: DMSO (Bioshop Canada, DMS666), Doxorubicin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Anastasiya Sybirna, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 6-well EZSPHERE microplates (ReproCELL) were used (500,000 cells/well in 3 mL PGCLC medium) ...
-
No products found
because this supplier's products are not listed.
Sudha Silwal Gautam, et al.,
bioRxiv - Bioengineering 2020
Quote:
... pax 7 (1:1000, rabbit; Lifespan Biosciences, Inc., Seattle, WA, USA), S100 (1:100 ...
-
No products found
because this supplier's products are not listed.
Takahiro Mitani, et al.,
bioRxiv - Biophysics 2022
Quote:
... Monomeric actin (G-actin) was loaded onto a 1 × 7 cm desalting column (Toyopeal 40S-HW, TOSOH, Japan) equilibrated with 1 mM ATP pH 7.0 and 0.1 mM CaCl2 ...
-
No products found
because this supplier's products are not listed.
Ian W. McCahill, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 2 media (Caisson Labs). Aqueous solutions of paclobutrazol and GA3 were freshly prepared and diluted to 0.1 µM and 10 µM respectively in hydroponic media ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Skye R.S. Fishbein, et al.,
bioRxiv - Microbiology 2019
Quote:
... One microgram of each of the fractions was injected on a 75um ID Picofrit column (New Objective, Woburn, MA) packed with Reprosil-Pur C18-AQ 1.9um beads (Dr ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Philip Pickford, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Ultrathin 70 nm sections were cut en face with a diamond knife (DiATOME) and imaged as above ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The silicon cuff was placed around the nerve and closed with one stitch of 6-O nylon suture (McKesson, REF S1698GX), and the receiver was placed subcutaneously proximal to the cuff ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
One μg of recombinant (Epicypher) or cellular nucleosomes (see protein purification above ...
-
No products found
because this supplier's products are not listed.
Tomoya Sasahara, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Counterstaining was carried out with 4’,6-diamidino-2-phenylindole (DAPI, 1:500; Dojindo Molecular Technologies, Kumamoto, Japan). Fluorescence images were acquired with a confocal laser-scanning microscope LSM710 (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Kavya Prasad, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mounted in Vectashield Antifade solution (4’,6 diamidino-2-phenylindole, Vector laboratories H-1200, Axxora/Alexis, Lörrach, Germany) with DAPI and cover with 24×60 mm coverslip sealed with a nail polish ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Dmt = 2’,6’-dimethylthyrosine) and SS20 (Phe-D-Arg-Phe-Lys-NH2) were obtained from Biomatik (https://www.biomatik.com). SS31 and SS20 were administered intraperitoneally to APP/PS1 Tg and non-transgenic littermate mice (5mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Christina Strauch, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and nuclei were visualized using 4’,6-diamidino-2-phenylindole (DAPI) in mounting medium (SCR-038448; Dianova, Hamburg, Germany).
-
No products found
because this supplier's products are not listed.
Minal Engavale, et al.,
bioRxiv - Immunology 2023
Quote:
... Portions of the blot were incubated with one of the following primary antibodies for 2 hours at room temperature or overnight: anti-human Dnase1L3 (1:1000) (Abnova and Genetex), pre-immune rabbit serum (1:5000) ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
Isabella Vlisidou, et al.,
bioRxiv - Microbiology 2019
Quote:
... were added to one BioPORTER tube (Genlantis) and resuspended in 920 μl of DMEM ...
-
Recombinant Antigen
Cat# REC31676-100,
100µg USD $837.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Ning Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... One mM final concentration of H-Bpa-OH (Chempep) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Daniel P Myatt, et al.,
bioRxiv - Biophysics 2022
Quote:
... (6) using plasmid DNA purchased from Aldevron, UK with the reaction optimised as per the design-of-experiment (DOE ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... difficile agar base (Oxoid) supplemented with 7% defibrinated horse blood (HemoStat Laboratories), 32 mg/L moxalactam (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Kathrin Frey, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All-in-one ready-to-use (Cell Applications Inc, 211A-500) without antibiotics.
-
No products found
because this supplier's products are not listed.
Maitreyi S. Joshi, et al.,
bioRxiv - Systems Biology 2022
Quote:
... atto-590azide (6 mM, ATTO-TEC GmbH, Siegen, Germany) dissolved in DMSO was mixed with aqueous solution of click-chemistry grade CuSO4 (40mM ...
-
No products found
because this supplier's products are not listed.
Thomas HB FitzGerald, et al.,
bioRxiv - Neuroscience 2019
Quote:
... which probabilistically generate one of two possible observations ot ∈ {1,2} (Costa et al., 2015; FitzGerald et al. ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Marie-Françoise Montaron, et al.,
bioRxiv - Neuroscience 2020
Quote:
One-of-ten series was incubated with a rat monoclonal anti-BrdU antibody (1/200, Accurate Chemical) and with a mouse monoclonal anti-NeuN antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... was added to sample 2 (DUBPAN) and 2 μl of OTUB1 (LifeSensors, Cat#: DB201) was added to sample 3 (DUBK48) ...
-
No products found
because this supplier's products are not listed.
Zhipeng Li, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Solution standard: 2 µl of calibration standard #2 (“CEM2”, LGC Standards #VHG-SM70B-100) was added to 200 µl of 50% HNO3 and heated for 2 hrs at 90°C in a loosely capped 15ml centrifuge tube (VWR ...
-
No products found
because this supplier's products are not listed.
Dimitrios Papagiannidis, et al.,
bioRxiv - Cell Biology 2021
Quote:
... One-hundred microliters of each sample was transferred into 96 well glass bottomed microtiter plates (Brooks Life Sciences, Chelmsford, Massachusetts) coated with concanavalin A and allowed to attach ...
-
No products found
because this supplier's products are not listed.
Xingjie Ren, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were washed twice with Buffer 2 and resuspended in 50 µl Buffer 2 with antibody (antibodies-online Inc. ...
-
No products found
because this supplier's products are not listed.
Sandeep Ameta, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... DNA/RNA oligonucleotides (Supplementary File 2) were obtained from IDT DNA technologies.
-
No products found
because this supplier's products are not listed.
Zachary B. Hancock, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Jamilla Akhund-Zade, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
The MA and FL traps were created by cutting an approximately 2 inch-square flap into an empty one-gallon plastic ethanol jug (Koptec, Decon Labs) and baiting them with a fruit and wine mixture ...
-
No products found
because this supplier's products are not listed.
A.K. Sulit, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2/1/56 FAA), and Porphyromonas asaccharolytica (CC44 001F, and CC1/6 F2) using Bacterial Lipopolysaccharides (LPS) Extraction Kit (Alpha Diagnostic International, Catalog # 1000-100-LPS) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
Pinja Kettunen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM Xav939 (BioGems).
-
No products found
because this supplier's products are not listed.
Chamandi S. Dampalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... SARS-CoV-2 3CLpro complex with compound 2: Index HT screen (Rigaku Reagents) condition G8 (25% (w/v ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...