-
Carbohydrate
Cat# GMS0314S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Chenxin Li, et al.,
bioRxiv - Plant Biology 2022
Quote:
Catharanthus roseus cv ‘SunstormTM Apricot’ leaf tissue collected at the same time as one replicate of the 10x scRNA-seq experiments was used with the Proximo Hi-C kit (Phase Genomics; CRO_AR) to generate Hi-C reads and sequenced on the Illumina NovaSeq 6000 generating paired-end 150 nt reads ...
-
No products found
because this supplier's products are not listed.
Maxence Le Vasseur, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Gel slices (2mm x 7mm) were excised along the entire lane using disposable gel cutter grids (The Gel Company, San Francisco, CA, cat# MEE2-7-25). Ten gel slices ranging from ∼600-900kDa were collected in 100µl of 50mM ammonium bicarbonate (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Rajashree A. Deshpande, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 2 µL of 100 µM caged AluGG crRNA (Bio-Synthesis)36 was mixed with 2 µL of 100 µM tracrRNA (Integrated DNA Technologies ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Kei Jokura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... COS-7 cells (Angio-proteomie, CAT no. cAP-0203) with a low endogenous level of soluble guanylate cyclase activity were used ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Vivian Tam, et al.,
bioRxiv - Systems Biology 2020
Quote:
... (McGill University) and one aged (59M) from Articular Engineering, LLC (IL ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Sergio M. Pontejo, Philip M. Murphy,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with TMB One Component (Surmodics, Eden Prairie, MN) and the reaction was stopped with sulfuric acid before measuring the absorbance at 450 nm (A450 ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
David S. Milner, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 2 Bacteriological (Neogen)] or Scm-his agar (containing CSM-histidine in place of CSM-uracil) ...
-
No products found
because this supplier's products are not listed.
Yuta Fujii, et al.,
bioRxiv - Plant Biology 2020
Quote:
One-day-old gemmalings were incubated in temperature-controlled incubators (IJ100, Yamato Scientific Co., LTD) and light conditions were adjusted using blue light-emitting diodes (LEDs ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Frøydis Sved Skottvoll, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-MAM-d6 and morphine-d3 were purchased from Cerilliant (Austin, TX, USA). Unless otherwise stated ...
-
No products found
because this supplier's products are not listed.
Carole Y. Perrot, et al.,
bioRxiv - Immunology 2023
Quote:
... immersed in a pH=6 antigen retrieval solution (IHC World, Elliott City, MD) and placed in a steamer for 40 min at 95-98°C ...
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and fractions 7 through 23 were collected using an automated fraction collector (Izon Science Ltd, 500 µL per fraction). A high sensitivity BCA assay (Pierce ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... to check for variability over time and ii) a one-way (GVS: LGVS vs. RGVS vs. Sham) ANOVA on the averaged proprioceptive drift values of the two visual capture conditions ...
-
No products found
because this supplier's products are not listed.
Mahmoud M. Elguindy, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Chromosome enumeration probes for chromosome 7 (CHR7-10-GR) and chromosome 20 (CHR20-10-RE) were purchased from Empire Genomics. Cells were trypsinized ...
-
The PRG-2 formulation allows a very substantial reduction (<40%) in the amount of Trypsin (BAEE...
Cat# 4Z0-310,
100.0 mL, $68.0
Ask
Lorna Ewart, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2% Culture-Boost (Cell Systems), and 10% Fetal Bovine Serum (FBS ...
-
No products found
because this supplier's products are not listed.
Adam R. Barno, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The six complete circular phages containing at least one AMG were visualized using DNAplotter (Carver et al., 2009).
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Chai-An Mao, et al.,
bioRxiv - Neuroscience 2020
Quote:
One μl of anti-melanopsin conjugated with saporin (Melanopsin-SAP, 400 μg/ml, Advance Targeting System, San Diego, CA) was injected into the vitreous of the right eye of Tbr2TauGFP/+ mice using a 33-gauge NanoFil system (World Precision Instruments ...
-
No products found
because this supplier's products are not listed.
Satish K. Tadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples were then loaded into custom-made C18 StageTips packed by stacking one AttractSPE® disk (#SPE-Disks-Bio-C18-100.47.20 Affinisep) and 2mg beads (#186004521 SepPak C18 Cartridge Waters ...
-
No products found
because this supplier's products are not listed.
Nisha Dhanushkodi, et al.,
bioRxiv - Immunology 2022
Quote:
... HSV-2 DNA copy number was determined using purified HSV-2 DNA (Advanced Biotechnologies, Columbia, MD) and based on a standard curve of the CT values ...
-
No products found
because this supplier's products are not listed.
Zhifen Cui, et al.,
bioRxiv - Microbiology 2021
Quote:
... were generated by simultaneously mixing one volume of lipid mixture (25 : 5: 19.3 : 0.8 : 50 molar ratio) of DLin-MC3-DMA (MedKoo Biosciences, #555308), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine ...
-
No products found
because this supplier's products are not listed.
Kärt Mätlik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cerebella were soaked in the DNA for 15-20 minutes on ice and were transferred one at a time into the well of an electroporation chamber (Protech International Inc ...
-
No products found
because this supplier's products are not listed.
Sang Hyuk Lee, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... A magnetic stir rod was added to one of the two flasks along with 100g of Alconox® powder (Alconox, NY). This flask was placed on a Nuova Stir Plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Sebastian Schaefer, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2-(butylthiocarbonothioylthio)propanoic acid (BTPA, Boron Molecular) and 5,10,15,20-tetraphenyl-21H,23H-porphine zinc (ZnTPP ...
-
No products found
because this supplier's products are not listed.
Aswini Panigrahi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Anti-Sulf-2 monoclonal antibodies (QED Bioscience), Anti-LG3BP monoclonal antibody (Proteintech) ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
Cat# CP-LMK-010,
inquiry, contact supplier for pricing
Ask
J. M. Kirkland, et al.,
bioRxiv - Neuroscience 2023
Quote:
Homogenate from two sex- and manipulation-matched rats were pooled into one sample for proteomic analysis carried out by Creative Proteomics (https://www.creative-proteomics.com/).
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Microglia interleukines production was analyzed the same way with the Mouse Interleukin 6 ELISA Kit (Biosensis®, BEK-2043-1P) and the Mouse Interleukin 10 ELISA Kit (Biosensis® ...
-
No products found
because this supplier's products are not listed.
Dieter G. Müller, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Colchicine treatment was performed using a disk of filter paper of 6 mm diameter loaded with 1 mg of colchicine (Fluka, Honeywell Research Chemicals), which was placed in the centre of an agar plate filled with gametophyte material ...
-
No products found
because this supplier's products are not listed.
Agnes Ulfig, et al.,
bioRxiv - Biochemistry 2019
Quote:
α2-Macroglobulin was purified from human plasma (obtained from Zen-Bio, Inc. ...
-
No products found
because this supplier's products are not listed.
J Paes de Faria, et al.,
bioRxiv - Neuroscience 2022
Quote:
... interleaved with the incubation with 4,6-diamidino-2-phenylindole (DAPI, Alfagene) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and chicken anti-microtubule associated protein 2 (MAP2, 1:500, EnCor Biotechnology Inc, FL, USA), followed by an incubation (3 days ...