-
No products found
because this supplier's products are not listed.
Ruddi Rodríguez-García, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1-oleoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl}-sn-glycero-3-phosphocoline (NBD-PC) were purchased from Avanti Polar Lipids. Cholesterol was purchased from Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Mizuki Honda, et al.,
bioRxiv - Genomics 2020
Quote:
... Nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) were used for the colorimetric detection of alkaline phosphatase activity ...
-
No products found
because this supplier's products are not listed.
Kuanxiang Sun, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cells were incubated with 10μM 1,2-dioleoyl-sn-glycero-3-phospho-L-serine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (18:1 NBD-PS) (1:300, Sigma-Aldrich) for 15 minutes at 25°C ...
-
No products found
because this supplier's products are not listed.
Justin A. Peruzzi, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
No products found
because this supplier's products are not listed.
Chidiebere Akusobi, et al.,
bioRxiv - Microbiology 2022
Quote:
NADA (3-[(7-Nitro-2,1,3-benzoxadiazol-4-yl)amino]-D-alanine hydrochloride) was synthesized by Tocris following the published protocol (31) ...
-
No products found
because this supplier's products are not listed.
Noelia Lozano-Vidal, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
MG Booty, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Caspase 3/7 indicator dye (Sartorius, Germany) and propidium iodide (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Dominik P. Elmer, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
No products found
because this supplier's products are not listed.
Analía Lima, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
Mégane Brusson, et al.,
bioRxiv - Genetics 2022
Quote:
... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
No products found
because this supplier's products are not listed.
Rishikesh U. Kulkarni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... subthreshold activity was abolished with glutamate receptor antagonists 2,3-Dioxo-6-nitro-1,2,3,4-tetrahydrobenzo-[f]quinoxaline-7-sulfonamide (NBQX; 10 μM; Santa Cruz Biotechnology) and DL-2-Amino-5-phosphonopentanoic acid (APV ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Hyungsoo Kim, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and V5-tag (7/4, Biolegend).
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Phillip Zhu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Elizabeth M Avegno, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2,3-Dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX; 10 μM; R&D Systems) was then added to determine the effect of AMPA receptor blockade on ePSCs ...
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using pulled borosilicate glass pipettes (4-7 MΩ resistance, Sutter Instrument) filled with an internal solution (in mM ...
-
No products found
because this supplier's products are not listed.
Muriel Sébastien, et al.,
bioRxiv - Cell Biology 2024
Quote:
... They were grown for 3-7 days in BrainPhys basal media (#05790, Stemcell Technologies), supplemented with SM1 (#05711 ...
-
No products found
because this supplier's products are not listed.
Kendell M Pawelec, et al.,
bioRxiv - Bioengineering 2023
Quote:
... BALB/c Mice (N=3 adult male, 7 months old; Charles River Laboratories) were used for this surgical implantation and μCT imaging pilot study ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... The membranes were washed 3 times in TBST for 15 minutes each and blots were developed with BCIP/NBT (5-bromo-4-chloro-3-indoyl-phosphate/nitro blue tetrazolium) color development substrate (VWR).
-
No products found
because this supplier's products are not listed.
Robin W. Yeo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or 7 days prior to intracardiac perfusion with 4% paraformaldehyde (PFA) (Electron Microscopy Sciences, 15714) in PBS ...
-
No products found
because this supplier's products are not listed.
Joseph Chapman, et al.,
bioRxiv - Biochemistry 2019
Quote:
1-methyl-3-nitro-1-nitrosoguanidine (MNNG) was purchased from TCI America and dissolved in DMSO as a 1 M stock ...
-
No products found
because this supplier's products are not listed.
Alexander M. Horspool, et al.,
bioRxiv - Microbiology 2021
Quote:
... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ...
-
No products found
because this supplier's products are not listed.
Margarita Anisimova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The patch electrodes (3-4 MΩ, World Precision Instruments; 1B150F-3) were filled with intracellular solution containing ...
-
No products found
because this supplier's products are not listed.
Kirsten Lex, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 4 and 7 days-post injection using a fluorescent stereoscope (Leica M205FA). Transplanted larvae were kept in individual wells of a 6 well-plate to allow individual tracking of melanoma progression ...
-
No products found
because this supplier's products are not listed.
Anna C. Dragon, et al.,
bioRxiv - Immunology 2023
Quote:
... with 3% human serum (c.c.pro; CTL medium) supplemented with 12.5 ng/ml IL-7 and IL-15 (PeproTech). On day 1 ...
-
No products found
because this supplier's products are not listed.
Hiroshi Nishiyama, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the AMPA-R antagonist 2,3-Dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX;10 μM HB0443, Hello Bio) and NMDA-R antagonist DL-2-Amino-5-phosphonopentanoic acid (DL-APV ...
-
No products found
because this supplier's products are not listed.
Zhe Zhang, Jay R. Gibson, Kimberly M. Huber,
bioRxiv - Neuroscience 2021
Quote:
... Whole cell recordings of L2/3 and L5 pyramidal neurons were obtained using borosilicate pipettes (4-7 MΩ) and a Multiclamp 700A amplifier (Molecular Devices). Internal solution contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Colleen E. O’Connor, et al.,
bioRxiv - Bioengineering 2023
Quote:
Primary human umbilical vein endothelial cells (HUVECs; Lonza; passages 4 to 7) were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2 ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Fernando R. Valencia, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 7.5 and 10 μM (S)-nitro-blebbistatin (Toronto Research Chemicals), 2 μM Y-27632 ROCK inhibitor (EMD Millipore) ...
-
No products found
because this supplier's products are not listed.
Constanza Salinas-Rebolledo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Z-RLRGG-7-amino-4-methyl-courmarin (peptide-AMC) was purchased from Bachem. Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC ...
-
No products found
because this supplier's products are not listed.
Weihua Zhou, et al.,
bioRxiv - Neuroscience 2020
Quote:
... C.B-17 SCID mice (female, 4-7 weeks old) were obtained from Envigo and maintained in specific pathogen-free conditions ...
-
No products found
because this supplier's products are not listed.
Jenni Schulz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with this number based on power analysis for a mixed-effects analysis at the group-level.45 Pilot-data from two preliminary studies were used for the power calculation (three subjects (2M/1F 28 ± 4 yrs) and 7 subjects (3M/4F 25 ±4 yrs)).43 ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Lamuk Zaveri, Jyotsna Dhawan,
bioRxiv - Cell Biology 2021
Quote:
... Klf4 or Oct-3/4 or Klf4 + Oct-3/4 or Klf4 + OctER using PEI (Polysciences, USA). Self-ligated empty pGEM-T vector (Promega ...