-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Sergio M. Pontejo, Philip M. Murphy,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with TMB One Component (Surmodics, Eden Prairie, MN) and the reaction was stopped with sulfuric acid before measuring the absorbance at 450 nm (A450 ...
-
No products found
because this supplier's products are not listed.
Mariano R. Rodríguez-Sosa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Ad-MSC were incubated for 30 min with 1/3 dilution of Propidium Iodide (PI) solution (Cytognos, Spain) in PBS 1X ...
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
Yuta Fujii, et al.,
bioRxiv - Plant Biology 2020
Quote:
One-day-old gemmalings were incubated in temperature-controlled incubators (IJ100, Yamato Scientific Co., LTD) and light conditions were adjusted using blue light-emitting diodes (LEDs ...
-
No products found
because this supplier's products are not listed.
Michael B. Geary, et al.,
bioRxiv - Pathology 2022
Quote:
... and the skin was closed with either 7 mm stainless steel wound clips (CellPoint Scientific Inc., Gaithersburg, MD) or a series of interrupted 5-0 nylon sutures ...
-
No products found
because this supplier's products are not listed.
Catherine C. Neto, et al.,
bioRxiv - Microbiology 2021
Quote:
... quercetin-3-O-galactoside or hyperoside (Chromadex, Irvine, CA); procyanidin-A2 (Indofine Inc. ...
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and then incubated with 150 μl of FLAG elution buffer (FLAG wash buffer 2 with 1 mg/ml 3×FLAG peptide [Protein Ark, GEN-3XFLAG-25]) overnight ...
-
No products found
because this supplier's products are not listed.
Shoib S. Siddiqui, et al.,
bioRxiv - Immunology 2020
Quote:
... or 3’-sialyllactose-PAA-biotinylated (Glycotech, Catalogue number-01-038), diluted in binding buffer ...
-
Cat# ACT-CBMN-7,
USD $529.52/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Meilin Zhu, et al.,
bioRxiv - Microbiology 2023
Quote:
... four parts MRS+CQ broth was combined with one part Cleanascite™ Lipid Removal Reagent (Biotech Support Group #X2555-10) and shaken (220 rpm ...
-
No products found
because this supplier's products are not listed.
Chenxin Li, et al.,
bioRxiv - Plant Biology 2022
Quote:
Catharanthus roseus cv ‘SunstormTM Apricot’ leaf tissue collected at the same time as one replicate of the 10x scRNA-seq experiments was used with the Proximo Hi-C kit (Phase Genomics; CRO_AR) to generate Hi-C reads and sequenced on the Illumina NovaSeq 6000 generating paired-end 150 nt reads ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Joshua Johnson, et al.,
bioRxiv - Physiology 2020
Quote:
... Endogenous peroxidase blocking was performed by using 3% hydrogen peroxide (Labchem, Cat # LC154301). Sections were then washed in water ...
-
Creative-Proteomics Human Obesity Glass protein array, detected 4 Human proteins. Suitable for...
Cat# HQ-OPA-CPG-1,
inquiry, contact supplier for pricing
Ask
J. M. Kirkland, et al.,
bioRxiv - Neuroscience 2023
Quote:
Homogenate from two sex- and manipulation-matched rats were pooled into one sample for proteomic analysis carried out by Creative Proteomics (https://www.creative-proteomics.com/).
-
No products found
because this supplier's products are not listed.
Mackenzie T. Walls, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... the overnight culture was used to inoculate 3 mL of SC media (Sunrise Science Products) with 2% (w/v ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Benjamin M. David, Paul A. Jensen,
bioRxiv - Systems Biology 2022
Quote:
... Samples were homogenized for 3 minutes in two 90 s intervals at 1600 rpm (OHAUS homogenizer), then heated at 65 °C for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Safwan K. Elkhatib, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and plasma were assessed using 3-CAT research ELISA (Rocky Mountain Diagnostics, BAE-5600, Colorado Springs, CO, USA) which had a corrected NE lower limit of detection of 30 pg/mL ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... Id3 (1:1000; 6-1, CalBioreagents), Usp1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Katherine Berman, et al.,
bioRxiv - Immunology 2024
Quote:
... A set of 87 COVID-19 negative serum samples collected between 3/24/2017 and 11/9/2018 was also purchased from Access Biologicals, LLC ...
-
No products found
because this supplier's products are not listed.
Risa Kato, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... They were housed in standard cages (175 × 245 × 125 mm) containing approximately 3 mm grain-size corn cob bedding (“Shepherd’s Cob,” Shepherd Specialty Papers, USA) and nesting material (“Parumasu ¼,” Material Research Center Co. ...
-
No products found
because this supplier's products are not listed.
Shannon J. McKie, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1 mM DTT and 1 mM ATP) and 2.5 nM negatively supercoiled pBR322* (Inspiralis) or singly-linked catenanes (Inspiralis ...
-
No products found
because this supplier's products are not listed.
Jennifer B. Phillips, et al.,
bioRxiv - Neuroscience 2023
Quote:
... α-PCDH15: 1:200 (NSJ Bioreagents); Alexafluor Goat anti-rabbit 488 or 568 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Enikő Lázár, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... 1 U/µl RiboProtect (BLIRT, RT35), 1.0 U/µl T4 Rnl2 (NEB ...
-
No products found
because this supplier's products are not listed.
Momoe Nakajo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Flash-frozen 50-μL bacterial pellets were dissolved in 500 μL binding buffer (PBS with 0.5 mM EDTA, 1 mM DTT, 1 mM PMSF, 26.3 μM MG-132 [Chemscene, New Jersey ...
-
No products found
because this supplier's products are not listed.
Rebecca Guth-Metzler, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1 µL of each reverse transcription was combined with 1 µL GenefloTM 625 size standard ROX ladder (CHIMERx) and 20 µL HiDi (Applied Biosystems) ...
-
No products found
because this supplier's products are not listed.
Jen M. Hope, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
PC12 cells (NeuroScreen-1 subclone, Cellomics, discontinued) were maintained in complete medium (F12K supplemented with 15% horse serum and 2.5% FBS ...
-
No products found
because this supplier's products are not listed.
Qian Yu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... bovine insulin (1 μg/ml, Akron Biotech), and penicillin/streptomycin for 24 h and then in antibiotic-free media for another 24 h ...
-
No products found
because this supplier's products are not listed.
Rahul Sharma, Martin W. Hetzer,
bioRxiv - Cell Biology 2022
Quote:
... mouse Nesprin3 (Nordic-MUBio # MUB1317P,1:250); rabbit Emerin D3B9G XP (CST # 30853) ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Selma Piranej, et al.,
bioRxiv - Biophysics 2023
Quote:
... Azide-functionalized particles were then synthesized by mixing 1 mg of aminated silica and polystyrene beads with 1 mg of azido acetic NHS ester (BroadPharm #BP-22467). This mixture was subsequently diluted in 100 μL of dimethylsulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals). Non-phosphorylated Ub protein (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Ann-Sofie Thorsen, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... tissue was mounted on 1 mm inserts (iSpacer, SunJin Lab.) on glass-slides in RapiClear and subjected to imaging on a TCS SP5 confocal microscope (Leica).
-
No products found
because this supplier's products are not listed.
Lin Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and NKX3.1 (0314, dilution 1:500, Athena Enzyme Systems, Baltimore, MD). Images were taken using a Zeiss microscope (White Plains ...
-
No products found
because this supplier's products are not listed.
Jonard C. Valdoz, et al.,
bioRxiv - Bioengineering 2022
Quote:
... respectively and strained using a 100 µm cell strainer (15-1100-1, Biologix Research Company, MO, USA) twice ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...