-
No products found
because this supplier's products are not listed.
Bettina M. Fuglerud, et al.,
bioRxiv - Genomics 2021
Quote:
... at 4 °C overnight in CHAPS immunoprecipitation buffer (Fivephoton Biochemicals). After washing in TBST ...
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Yannick O Alexandre, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight at 4°C with 10 μg/ml HSV-1 inactivated Vero cell extract (Advanced Biotechnologies). Unbound protein was washed away (PBS 0.05% Tween20 ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... HBMECs at density of 3 to 4 × 105/cm2 were seeded onto glass coverslips coated with attachment factor (Cell Systems; Catalogue number: 4Z0-201) within 6-well plates at passage 7 ...
-
No products found
because this supplier's products are not listed.
Alexandra R. Willis, et al.,
bioRxiv - Microbiology 2021
Quote:
... Next,1,000 animals were placed on 6 cm plates in 400 μl total volume of M9 containing 10% (v/v) 10X OP50-1 and 4% (v/v) 0.2 μm green fluorescent polystyrene beads (Degradex Phosphorex). Where spores were included for the 3 h time point ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Emilie Pondeville, et al.,
bioRxiv - Genetics 2019
Quote:
... Hemocytes were incubated at 4°C overnight with a rat anti-mCD8 antibody (Ancell) diluted 1:100 or a rabbit anti-PPO2 (Fraiture ...
-
No products found
because this supplier's products are not listed.
Aldo E. García-Guerrero, et al.,
bioRxiv - Microbiology 2024
Quote:
... Membranes were blocked at room temperature for 1 hour in 5% skim milk/PBS and probed overnight at 4°C with 1:1000 dilutions of rabbit anti-HSP60 (Novus NBP2-12734) and goat anti-GFP (Antibodies.com A121560) antibodies ...
-
No products found
because this supplier's products are not listed.
Xiuting Liu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and three doses of clodronate-containing liposomes (Liposoma; 200 μL/each on days 4, 11, and 18). Control mice were treated with same doses/volume of IgG (clone HRPN ...
-
No products found
because this supplier's products are not listed.
Joanne L. Usher, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were spiked in at concentrations as indicated in the Supplementary Table 1 and the sample was loaded into a StageTip containing 4 plugs of C18 substrate (SPE-Disks-Bio-C18-100.47.20, AffiniSEP) that had been assembled ...
-
No products found
because this supplier's products are not listed.
Eun Hye Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cells were washed and stained with antibodies against cell surface molecules in PBS containing 4% of human serum (Valley Biomedical). NGFR was detected with a 20 μl per million cells of Alexa Flour 647 conjugated α-NGFR (BD Bioscience) ...
-
No products found
because this supplier's products are not listed.
Revital Bronstein, et al.,
bioRxiv - Genetics 2019
Quote:
... Blood samples from 4 individuals from family OGI-081 (197, 198, 200 and 340) were collected and reprogrammed by Cellular Dynamics, Inc (now FUJIFILM Cellular Dynamics ...
-
No products found
because this supplier's products are not listed.
Abigail R Marshall, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or ear clips (mice) were lysed for at least 4 h at 56°C in 50 µl lysis buffer (Viagen Biotech) with 10% proteinase K ...
-
No products found
because this supplier's products are not listed.
Brett E. Johnson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Immunofluorescence analyses of tumor tissue: FFPE human tissues were sectioned at 4 μm and mounted on adhesive slides (Mercedes Medical, TNR WHT45AD). The slides were baked overnight in an oven at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
William C Davis, et al.,
bioRxiv - Immunology 2019
Quote:
... and 100 μg/mL of streptomycin sulfate] in the presence of a DC growth cocktail containing bovine GM-CSF and IL-4 (Kingfisher Biotech, MN). On the third day ...
-
No products found
because this supplier's products are not listed.
Pierre-Emmanuel Y. N’Guetta, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Sections were incubated for 30 min in blocking solution (ice-cold PBS solution with 4% donkey serum (Equitech-Bio, Cat#SD30-0100), 1% bovine serum albumin (Fishersci ...
-
No products found
because this supplier's products are not listed.
Roie Cohen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Samples were then incubated overnight at 4°C in the appropriate primary antibody diluted in antibody diluent buffer (GBI labs cat: E09-300). Following 3 washes in PBS ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Lone Buchwaldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mycelium plugs were cut with a 7 mm cork borer from the margin of actively growing cultures and placed on 3 × 7 cm pieces of stretched Parafilm (Bemis Company Inc, Oshkosh, WI, USA) with the mycelium facing up ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... We purchased Target sequences for Bcl-2 miRNA 3’-UTR clone and the one with a site mutation at miR-383-binding site from Creative Biogene (Shirley, NY, USA). We seeded MiR-383-modified cells of GC in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Rashmi Chandra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... loaded with one zirconia silica bead (2.3 mm, OPS Diagnostics) per well ...
-
No products found
because this supplier's products are not listed.
Nuria Tubau-Juni, et al.,
bioRxiv - Immunology 2019
Quote:
... plates supplemented with 7% of Horse laked blood (Lampire Biological Laboratories, Pipersville, PA) and H ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
Larvae (7 dpf) were anesthetized with tricaine and injected with 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ~1.114 particles/ml in PBS) just as for the fluorescent tracer injections ...
-
No products found
because this supplier's products are not listed.
Richard J. Marsh, et al.,
bioRxiv - Cell Biology 2021
Quote:
COS-7 cells (CRL-1651, ATCC) cultured on 25-mm-diameter coverslips (CSHP-No1.5-25, Bioscience Tools) were first fixed with 37 °C pre-warmed 3% PFA (15710 ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... to check for variability over time and ii) a one-way (GVS: LGVS vs. RGVS vs. Sham) ANOVA on the averaged proprioceptive drift values of the two visual capture conditions ...
-
No products found
because this supplier's products are not listed.
Dimitrios Papagiannidis, et al.,
bioRxiv - Cell Biology 2021
Quote:
... One-hundred microliters of each sample was transferred into 96 well glass bottomed microtiter plates (Brooks Life Sciences, Chelmsford, Massachusetts) coated with concanavalin A and allowed to attach ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Manami Suzuki-Karasaki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals, Sapporo, Japan) for 20 min ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Tiphaine Péresse, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 1% antibiotics (Zell Shield, Minerva Biolabs) and were incubated at 37°C in a 5% CO2 humidified atmosphere ...
-
No products found
because this supplier's products are not listed.
Aviad Ben-Shmuel, et al.,
bioRxiv - Immunology 2021
Quote:
... Rabbit anti-pSHP-1 (S591) (ECM Biosciences), Rabbit anti-pPLCγ1 (Y783 ...
-
No products found
because this supplier's products are not listed.
Laura Virtanen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... rat monoclonal HSF1 (1:400, 10H8, StressMarq Bioscience Inc.), rabbit monoclonal Lap2α (1:1000 ...
-
No products found
because this supplier's products are not listed.
Heather A. Danhof, et al.,
bioRxiv - Microbiology 2023
Quote:
... and the slides were incubated at 4°C in a humid slide staining tray (Newcomer Supply, Middleton, WI, USA) overnight ...
-
No products found
because this supplier's products are not listed.
Alan P. R. Lorenzetti, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Cell pellets were resuspended in Milli-Q water and disrupted at 4°C using ceramic beads (Mo Bio Laboratories) and a Precellys 24 homogenizer (Bertin Corp). Protein content was determined by bicinchoninic acid assay (BCA ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific, or Nichirei Biosciences Inc) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Junnosuke Nakamura, et al.,
bioRxiv - Physiology 2023
Quote:
... 1 mM DTT) and homogenized by DIGITAL HOMOGENIZER (As One International, Inc.). Lysates were centrifuged at 14,000 rpm for 5 min ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Malwina Brożyna, et al.,
bioRxiv - Microbiology 2023
Quote:
... 100 µL of the solution was transferred from one well in four replicates to 96-well plates (Wuxi Nest Biotechnology, China), and the absorbance was measured at 490 nm using a spectrophotometer (Multiskan Go ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Immunology 2021
Quote:
... and RNA quality was examined by electrophoresing 1 μg of RNA on a 1% agarose gel containing 1% bleach (Aranda et al., 2012) and 1 × RedSafe nucleic acid staining solution (FroggaBio) in 1 × TAE buffer at 100 V for 35 min ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 µg of His-tagged HIV-1 JR-CSF gp120 (Immune Technology) was added to cells for 15 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Celine Everaert, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and 1 µl reaction buffer (ArcticZymes 66001). Of the resulting volume ...