-
Cat# HY-N4162-1 mg,
1 mg, USD $300.0
Ask
Guohui Zhang, et al.,
bioRxiv - Biophysics 2022
Quote:
BC5 (ARG-4-Methoxy-2-Naphthylamine, ordered from Medchemexpress LLC Monmouth Junction, NJ) was dissolved into DMSO to make 100 mM stock solution and then added to recording solutions to the final concentrations ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Zahraa Alraies, et al.,
bioRxiv - Cell Biology 2023
Quote:
Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Ryan A.V. Bell, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and recombinant active caspase 3 (0.5 μg; Chemicon) or recombinant active caspase 7 (0.5 μg; Biovision) were incubated for 3 h in cleavage assay buffer (50 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or 7-Amino-Actinomycin D (7-AAD, Beckman Coulter, B88526) was added to the cell suspensions ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... pH 7 (Polysciences) to transfect 293Freestyle cells ...
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Mathijs P. Verhagen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... mice were administered 2-3% dextran sodium sulfate (DSS) in their drinking water for 7 days (#0216011050, MP Biomedicals). DSS-driven inflammation and the corresponding mechanisms underlying the consequent PC dedifferentiation were described in previous studies(11 ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ...
-
No products found
because this supplier's products are not listed.
Thomas J. Diprospero, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 7-hydroxycoumarin-d5-sulfate and 7-hydroxycoumarin-13C6-glucuronide were purchased from Toronto Research Chemicals. 4-hydroxymephenytoin-d3 was purchased from MuseChem ...
-
No products found
because this supplier's products are not listed.
Prasath Paramasivam, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N [methoxy (polyethyleneglycol)-2000] (DMPE-PEG2000, NOF Corporation) and contained CleanCap® Enhanced Green Fluorescent Protein (eGFP) mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7201) and/or Clean Cap®Cyanine5 (Cy5 ...
-
No products found
because this supplier's products are not listed.
Omar A. Saldarriaga, et al.,
bioRxiv - Pathology 2019
Quote:
... 7-color manual IHC kit (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
Andreas Mund, et al.,
bioRxiv - Systems Biology 2021
Quote:
... #415190-9041-000) were treated with UV light for 1 h and coated with APES (3-aminopropyltriethoxysilane) using Vectabond reagent (Vector Laboratories, Burlingame, CA, USA, cat. #SP-1800-7) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Yu-Cheng Chen, et al.,
bioRxiv - Bioengineering 2019
Quote:
... were coated with 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-5000] (DSPE-PEG, Nanocs) in order to reach a stable nanoparticle dispersion in aqueous solution ...
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Actin (2µM; 7% pyrene-labeled) was then polymerized in the presence of 20nM bovine Arp2/3 complex (Cytoskeleton Inc.) plus MBP-tagged fusion proteins in control buffer supplemented with 0.2mM ATP and 0.5mM DTT ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Samantha R. Weaver, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... PTH(7-34) (Bachem), or vehicle (0.1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
4-Nitroquinoline 1-oxide (4-Nitroquinoline-N-oxide, 4-NQO, 4NQO, 4Nqo, NQO, NQNO) is a highly...
Cat# E0155, SKU# E0155-100mg,
100mg, $70.00
Ask
Jeanne Corriveau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... HUVECs were serum starved in M199 media with 0.5% FBS for 3 h followed by a 7 h treatment with 1 μM group I PAK inhibitor FRAX1036 (Selleck Chemicals).
-
No products found
because this supplier's products are not listed.
Xinquan Liu, Debadyuti Ghosh,
bioRxiv - Bioengineering 2019
Quote:
... and Cyanine 7 (Cy7, Lumiprobe) was conjugated to monomeric BSA according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Sharon Khuzwayo, et al.,
bioRxiv - Immunology 2020
Quote:
... The following morning plates were washed with 1x PBS-T before being coated with 3 μg/mL streptavidin-ALP secondary antibody (Mabtech, clone 7-B6-1) and incubated for 2 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
M Bendahmane, et al.,
bioRxiv - Biophysics 2019
Quote:
... synaptotagmin-7 (rabbit polyclonal) are from Synaptic Systems.
-
No products found
because this supplier's products are not listed.
Ryszard S. Gomolka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked with 7% normal donkey serum (Jackson Immunoresearch) in PBS with 0.03% Triton-X-100 ...
-
No products found
because this supplier's products are not listed.
Jimin Lee, et al.,
bioRxiv - Biochemistry 2023
Quote:
... alcyone ACE2 dimer with 7 mM CHAPSO (Anatrace) were applied and blotted twice as previously described88 ...
-
No products found
because this supplier's products are not listed.
Nicolas Broguiere, et al.,
bioRxiv - Bioengineering 2019
Quote:
7-diethylamino 4-methylcoumarin (DEAC, 2a) was purchased from TCI Deutschland GmbH.
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Sven Hagemann, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
No products found
because this supplier's products are not listed.
Paloma García Casas, et al.,
bioRxiv - Cell Biology 2023
Quote:
COS-7 cells were seeded on µ-Dish 35 mm (Ibidi), co-transfected 24 h later with plasmids encoding ER-Mit RspA-splitFAST and either ER-StayGold ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Rinaldo D. D’Souza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... into one of ten cortical areas and performing iontophoretic injections (3 µA, 7 s on/off cycle for 7 minutes; Midgard current source; Stoelting) of biotinylated dextran amine (BDA ...
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cholic acid 7-sulfate (CA-S) and 3’-sialyllactose were purchased from Cayman (Biomol GmbH, Hamburg, Germany). Sulfate (S ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Shirsendu Ghosh, et al.,
bioRxiv - Biophysics 2020
Quote:
7) Glass bottom culture dish (MatTek, 35 mm petri dish ...
-
No products found
because this supplier's products are not listed.
Bogdan B. Grigorash, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Keratin 7 (Genetex #GTX110414; 1:250), Keratin 8 (DSHB Hybridoma Product TROMA-I ...
-
No products found
because this supplier's products are not listed.
Dennis Das Gupta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-IL-7 (BioXCell, 10 µg/ml), rmIL-7 or respective combinations ...
-
No products found
because this supplier's products are not listed.
Hélène Scheer, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 10 pmol of gene-specific primer (Supplementary Table 7) and 10 pmol of a TruSeq RNA PCR index (RPI, Supplementary Table 7) 10 nmol of dNTP ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Chikako Okubo, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse monoclonal anti-p53 (DO-7) (1:200, Novus Biologicals), goat polyclonal anti-p53 (1:100 ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Joseph Deering, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and pixel size of 7 nm on a Continuum S imaging filter (Gatan). EELS elemental maps for carbon ...
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Tal Iram, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using 7 cycles for chromatin shearing on a Bioruptor Pico sonicator (Diagenode, Cat. No. B01060001). Prior to sonication ...