-
No products found
because this supplier's products are not listed.
Jung Ho Hyun, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4-methoxy-7-nitroindolinyl-glutamate (MNI-caged glutamate, Tocris) was dissolved in Mg2+-free ACSF (4 mM Ca2+ ...
-
No products found
because this supplier's products are not listed.
Rebecca Keener, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 4-nitroquinoline (Sigma N8141) was resuspended in acetone at a stock concentration of 1 mM ...
-
No products found
because this supplier's products are not listed.
Gouranga Saha, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
No products found
because this supplier's products are not listed.
Sara Bermudez, et al.,
bioRxiv - Neuroscience 2024
Quote:
... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
No products found
because this supplier's products are not listed.
T.A. Hartjes, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG-DSPE, Avanti Polar Lipids) were dissolved in ethanol in a molar ratio of 53:42:5 to a final concentration of 10 mM total lipid (Batch 1 ...
-
No products found
because this supplier's products are not listed.
MG Booty, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Caspase 3/7 indicator dye (Sartorius, Germany) and propidium iodide (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Chisato M. Yamazaki, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and 1-methoxy-5-methylphenazinium methylsulfate (1-methoxy PMS, 100 μM, Cayman Chemical) was added to each well ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
No products found
because this supplier's products are not listed.
Jiapeng Liu, Christie Dapper, Michael Klemba,
bioRxiv - Microbiology 2023
Quote:
... 3- azido-7-hydroxycoumarin was acquired from Abcam. Piperazine-based MAGL inhibitors described in Aaltonen et al20 were provided by Dr ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Mégane Brusson, et al.,
bioRxiv - Genetics 2022
Quote:
... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
No products found
because this supplier's products are not listed.
Jose A. Valverde-Lopez, et al.,
bioRxiv - Developmental Biology 2023
Quote:
FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Gerarda H. Khan, et al.,
bioRxiv - Immunology 2023
Quote:
... 7-aminoactinomycin-D (7-AAD; BioLegend), FAS-PEcy7 (DX2 ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Paula Tucci, et al.,
bioRxiv - Microbiology 2019
Quote:
... Proteins were loaded into 7 cm IPG Strips 3-10 (GE Healthcare) by overnight passive rehydration ...
-
No products found
because this supplier's products are not listed.
Dan Xia, et al.,
bioRxiv - Neuroscience 2021
Quote:
... with 10 mg/kg methoxy-X04 (R&D Systems). Mice were perfused with PBS 24 hours after injection and cortical and hippocampal tissues were dissected and processed into single-cell suspension for staining as described above except the antibodies used for FACS were ...
-
No products found
because this supplier's products are not listed.
Anna C. Dragon, et al.,
bioRxiv - Immunology 2023
Quote:
... with 3% human serum (c.c.pro; CTL medium) supplemented with 12.5 ng/ml IL-7 and IL-15 (PeproTech). On day 1 ...
-
No products found
because this supplier's products are not listed.
Caleb Ruiz-Jiménez, et al.,
bioRxiv - Immunology 2021
Quote:
... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
No products found
because this supplier's products are not listed.
May Zaw Thin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 3 and 7 after renal artery injection using an IVIS Lumina (PerkinElmer, USA). Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega ...
-
No products found
because this supplier's products are not listed.
Moritz Hunkeler, Cyrus Y. Jin, Eric S. Fischer,
bioRxiv - Molecular Biology 2022
Quote:
pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Robert Schönherr, et al.,
bioRxiv - Biophysics 2023
Quote:
... at 40 °C and for 7 min in 3 % lead citrate (Ultrostain II, Leica) at 20 °C ...
-
No products found
because this supplier's products are not listed.
Tiantian Wu, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Coilin (Santa Cruz, F-7); Fibrillarin (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Kendell M Pawelec, et al.,
bioRxiv - Bioengineering 2023
Quote:
... BALB/c Mice (N=3 adult male, 7 months old; Charles River Laboratories) were used for this surgical implantation and μCT imaging pilot study ...
-
No products found
because this supplier's products are not listed.
Joseph W. Salatino, Arya P. Kale, Erin K. Purcell,
bioRxiv - Bioengineering 2019
Quote:
... Cells were harvested after 3 or 7 days post-transfection (RNEasy mini kit, Qiagen), whereby cDNA was made and amplified via qPCR with primers for GAPDH ...
-
No products found
because this supplier's products are not listed.
Constanza Salinas-Rebolledo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
No products found
because this supplier's products are not listed.
A. Singer, L. Vinel, F. Trigo, I. Llano, M. Oheim,
bioRxiv - Neuroscience 2023
Quote:
Glutamate was photolysed from 4-Methoxy-7-nitroindoli-inyl-caged-L-glutamate (MNI-GLutamate, HelloBio, Bristol, UK) by focusing the beam of a 405-nm diode laser (Obis ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Leonie Vollmar, et al.,
bioRxiv - Biophysics 2023
Quote:
... its surface is passivated with an 80:3 mixture of methoxy-polyethylene glycol-silane (5000 Dalton, Rapp Polymere) and silane-PEG-Biotin (3000 Dalton ...
-
No products found
because this supplier's products are not listed.
Timothy M. Otchy, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and the whole device rinsed in methoxy-nonafluorobutane (Novec 7100; 3M) to remove trace PGMEA residue ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
The International Brain Laboratory, et al.,
bioRxiv - Neuroscience 2020
Quote:
Animals (all female and male C57BL6/J mice aged 3-7 months obtained from Jackson Laboratory or Charles River) were co-housed whenever possible ...
-
No products found
because this supplier's products are not listed.
Christopher T. Schafer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Methoxy e-Coelenterazine (Prolume Purple) was purchased from Nanolight Technologies (Prolume LTD ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Muriel Sébastien, et al.,
bioRxiv - Cell Biology 2024
Quote:
... They were grown for 3-7 days in BrainPhys basal media (#05790, Stemcell Technologies), supplemented with SM1 (#05711 ...
-
No products found
because this supplier's products are not listed.
Jan Zlamal, et al.,
bioRxiv - Immunology 2022
Quote:
Immunofluorescence images were aquired from 3-5 randomly chosen microscopic fields in different fluorescence channels (x40 magnification) using a Zeiss Axio Observer 7 (Carl Zeiss, Oberkochen, Germany). Images were processed identically using adjusted threshold settings and exclusion of image artefacts by using Fiji image processing software.33 Thrombus formation was determined by measuring the surface area coverage (SAC ...
-
No products found
because this supplier's products are not listed.
Taiki Satoh, et al.,
bioRxiv - Immunology 2021
Quote:
... 10 ng/ml IL-7 (Miltenyi Biotec), 2 mM L-Glutamine ...
-
Building Block
Sold for research purposes only.
Cat# 1030.0, SKU# 1030-25 mg,
25mg, US $247.50 / EA, EURO, €225 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Fabrice C. Bernard, et al.,
bioRxiv - Bioengineering 2021
Quote:
40 kDa methoxy polyethylene glycol (PEG) amine (JenKem Technology) was purchased as a dry lyophilized powder for PEG tracer synthesis ...
-
No products found
because this supplier's products are not listed.
Jasmim Leal, et al.,
bioRxiv - Bioengineering 2019
Quote:
... were conjugated to methoxy-PEG-amine 1KDa (Alfa Aesar, MA) or custom synthesized peptides (LifeTein ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Joshua D. Kerkaert, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 300μL of XTT solution was added to each well (0.5mg/mL XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (VWR) with 25μM menadione in PBS) ...
-
No products found
because this supplier's products are not listed.
Hailey Axemaker, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The spheroids were grown for 21 days and imaged every 7 days with Cytation 3 Imaging reader (Biotek, Winooski, VT, USA). ImageJ software was used to measure the lengths and areas of the spheroids to compare the formed spheroids over time ...
-
No products found
because this supplier's products are not listed.
Katrine Wacenius Skov Alanin, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7) DC3000 − A (Illumina only), 8 ...
-
No products found
because this supplier's products are not listed.
Zhihang Yuan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Mathilde Ambrosino, et al.,
bioRxiv - Bioengineering 2023
Quote:
The size and shape of the microgels were observed under light microscopy over time (immediately after microencapsulation, then 1, 3, 7, and 14 days) using confocal microscopy Nikon A1RSi (Nikon Champigny sur Marne). The microgels were immersed in complete cell culture medium and stored at 37°C ...