-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2’,7’-dichlorodihydrofluorescein diacetate (DCFDA, Cell Biolabs) were used for mitochondrial and intracellular ROS staining ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Chisato Kunitomi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Female mice (3-4 weeks old) were intraperitoneally injected with 5 IU pregnant mare serum gonadotropin (PMSG; MyBioSource, MBS173236) to induce follicle growth ...
-
No products found
because this supplier's products are not listed.
Daniela Saderi, Brad N. Buran, Stephen V. David,
bioRxiv - Neuroscience 2019
Quote:
... 1 to 4 high-impedance tungsten microelectrodes (FHC or A-M Systems, impedance 1-5 MΩ) were slowly advanced into cortex with independent motorized microdrives (Alpha-Omega) ...
-
35 mm glass bottom dish with 4 chambers, 20mm microwell, #1 cover glass (0.13-0.16mm). Designed...
Cat# D35C4-20-1-N,
100/case, $184.00
Ask
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Bhagyashree Deshmukh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 2 mM PMSF) at parameters of 3 sec ON/ 5 sec OFF/ 60% amplitude (Probe sonicator Thomas Scientific). The supernatant was separated by spinning at 12,000 RPM ...
-
No products found
because this supplier's products are not listed.
Hui Zhang, et al.,
bioRxiv - Microbiology 2021
Quote:
... HEK293 cells were transiently co-transfected at a ratio of 1:2 (H:L) with PEI (49553-93-7, Polyscience) according to the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Per Niklas Hedde, et al.,
bioRxiv - Microbiology 2020
Quote:
... The microarray slides used consisted of 2 × 8 pads of 7 mm × 7 mm each (Oncyte Avid, Grace Bio-Labs, Bend, OR). In this configuration ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Claire V. Mulholland, et al.,
bioRxiv - Microbiology 2023
Quote:
Mtb cultures were grown to early log phase and then diluted to OD600 0.3 in 10 ml 7H9/OADC/glycerol/tyloxapol and labelled with propionic acid [1-14C] sodium salt (7 μCi) (American Radiolabeled Chemicals, Inc.). Cultures were incubated with shaking at 37 °C for two days and then spun down ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Eric Hee Jun Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Tumor tissue was fixed for up to 3 days in 4% paraformaldehyde (4% PFA, Boston BioProducts) and stored in 70% ethanol until further processing ...
-
No products found
because this supplier's products are not listed.
Naihua N. Gong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Flies aged 5-7 days were anesthetized on CO2 pads (Genesee Scientific Cat #59-114) and loaded into individual glass tubes (with 5% sucrose and 2% agar ...
-
No products found
because this supplier's products are not listed.
Alan Wanke, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and laminaripentaose β-1-3-(Glc)5 at a concentration of 1.5 mg·mL−1 were used as standards (Megazyme, Bray, Ireland). To visualize the glucan fragments ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Victoria A. Bonnell, et al.,
bioRxiv - Genomics 2023
Quote:
... Sonicate the chromatin until sufficiently sheared (130µL, 5% duty cycle, 75W peak incident power, 200 cycles per burst, 7°C, for 5 minutes using Covaris Focus-Ultrasonicator M220). The immunoprecipitation step included ...
-
No products found
because this supplier's products are not listed.
Drew T. Dunham, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 μg of RNA was ran on a 8% polyacrylamide urea gel (National Diagnostics SequaGel 1:4) in 1x TBE buffer (100mM Tris base ...
-
No products found
because this supplier's products are not listed.
Ming Zhou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
No products found
because this supplier's products are not listed.
H. Theobald, et al.,
bioRxiv - Immunology 2022
Quote:
... centrifuged at 1350 rpm for 5 min at 4°C and resuspended in 1 ml RPMI1640 (PAN Biotech) supplemented with 10% FCS (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The following primary antibodies were incubated in antibody buffer (Intercept blocking buffer diluted 1:1 in TBS containing 0.2 % tween 20) at 4 °C overnight: Mouse anti-DSG1/2 (61002, Progen, Heidelberg, Germany), mouse anti-DSP (61003 ...
-
No products found
because this supplier's products are not listed.
Yoann G. Santin, et al.,
bioRxiv - Microbiology 2023
Quote:
... manually back blotted for 3-4 secondes and flash-frozen in liquid ethane using a CP-3 plunger (Gatan). Data were collected on a 300-kV CRYO ARM™ 300 (JEM-Z300FSC ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... KHYG-1 cells was additionally supplemented with 5 ng/mL recombinant human IL-2 (ImmunoTools GmbH, Germany). Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3 ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... recombinant IL-4 and IL-5 (10 ng/mL; Tonbo Bioscience) cytokines ...
-
No products found
because this supplier's products are not listed.
Ji Wang, et al.,
bioRxiv - Pathology 2021
Quote:
... 5-7 μL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... we measured commercially available Quantum™ FITC-5 MESF (7 μm, Catalog No. 555, lot 14609, Bangs Laboratories) and AccuCheck ERF Reference Particles Kit (3 μm ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were washed 3 times in PBS and incubated for 2 h with adequate secondary antibody (Dianova, Hamburg, Germany; Table 1) solution without Triton™-X-100 ...
-
No products found
because this supplier's products are not listed.
Megan B. Borror, et al.,
bioRxiv - Pathology 2019
Quote:
R-loop formation in worms was quantified using αS9.6 primary antibody (Kerafast, 1:2000 in 5% Blotto, 16 hours, 4°C), previously shown to be selective for DNA::RNA hybrids 50 ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
Yonat Tzur, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 μg/sample was loaded onto 4-15% gradient polyacrylamide gels (Mini-PROTEAN TGX Gels, Bio-Rad, 4561083), transferred (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Yuan Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 4-1BB (Acrobiosystems) or BSA (Solarbio ...